LOC100001845

Ensembl ID:
ENSDARG00000077494
Human Orthologues:
SLX1A, SLX1B
Human Descriptions:
SLX1 structure-specific endonuclease subunit homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:20922
SLX1 structure-specific endonuclease subunit homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:28748
Mouse Orthologue:
Giyd2
Mouse Description:
GIY-YIG domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1915220]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14819 Nonsense Available for shipment Available now
sa27082 Nonsense Available for shipment Available now
sa41067 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111285 Nonsense 9 266 1 5
Genomic Location (Zv9):
Chromosome 7 (position 66031299)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59213039
KASP Assay ID:
2259-9717.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAAWAAGTTGTTTTAAACAGGATGGTTGTGGAGGTGGAGAGTTTCTA[T/A]GGTGTGTATATGTTGTACTGTACAAACCCGAAATTTAAGGGTCGAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27082
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111285 Nonsense 183 266 4 5
Genomic Location (Zv9):
Chromosome 7 (position 66029958)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59211698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAATAGTTGAGACTCATCCCTATTGGAATTACTTTTTTTTTTTTTTT[G/T]AATTGTTTCAGACTGTGGATAGATTGTCTTGTTTCCACCCTTCCTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111285 Essential Splice Site 255 266 4 5
Genomic Location (Zv9):
Chromosome 7 (position 66029738)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59211478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTATAAAAATGCAGACTTGGAAGAAATGAACATCCCTTCATCCCAGG[T/C]CAGCTCTGACATGCACCGTAAAACATCAATAATTAGTTTAATCAATTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link