LOC100001845

Ensembl ID:
ENSDARG00000077494
Human Orthologues:
SLX1A, SLX1B
Human Descriptions:
SLX1 structure-specific endonuclease subunit homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:20922
SLX1 structure-specific endonuclease subunit homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:28748
Mouse Orthologue:
Giyd2
Mouse Description:
GIY-YIG domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1915220]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14819 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111285 Nonsense 9 266 1 5
Genomic Location:
Chromosome 7 (position 66031299)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAAWAAGTTGTTTTAAACAGGATGGTTGTGGAGGTGGAGAGTTTCTA[T/A]GGTGTGTATATGTTGTACTGTACAAACCCGAAATTTAAGGGTCGAATATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rhnfkvwj