atp8a2

Ensembl ID:
ENSDARG00000077492
Human Orthologue:
ATP8A2
Human Description:
ATPase, aminophospholipid transporter, class I, type 8A, member 2 [Source:HGNC Symbol;Acc:13533]
Mouse Orthologue:
Atp8a2
Mouse Description:
ATPase, aminophospholipid transporter-like, class I, type 8A, member 2 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18573 Essential Splice Site Available for shipment Available now
sa24493 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16737 Essential Splice Site Available for shipment Available now
sa25213 Nonsense Mutation detected in F1 DNA During 2014
sa18465 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109848 Essential Splice Site 169 1189 5 36
Genomic Location:
Chromosome 24 (position 22062921)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTYCAGTTCTGCGTAACGGAGCATGGCAGACCATCATATGGAARCAG[G/A]TAACCCTGTCTTTTGCTCTTTTCCTGCATCTGTTATTCCYCTTTTCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109848 Essential Splice Site 422 1189 12 36
Genomic Location:
Chromosome 24 (position 22056285)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCCCGCTATGGCTCGAACGTCCAATCTGAATGAAGAACTCGGCCAAG[T/C]AAGAAAACACATTTACAAATGTTTATCTACCTCATCTCCATTACATCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109848 Essential Splice Site 624 1189 21 36
Genomic Location:
Chromosome 24 (position 22049872)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAKTTACTTGTAGTGTTTTGCCTTATGATTATTATTRTTRTTATCATTTC[G/A]CATKTGCAGGGCTGAGGACACTGTGTTTTGCGTATGTGGATCTCGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25213
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109848 Nonsense 668 1189 21 36
Genomic Location:
Chromosome 24 (position 22049738)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTATTAGCACTGTGTTAAAGGACCGAGCACAGAAACTGGAGGAGTGTTA[C/A]GAACTCATAGAGAAGGTATGTACTGTAATATATGCCATGTATGTCTAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109848 Nonsense 1048 1189 32 36
Genomic Location:
Chromosome 24 (position 22000158)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTRGCTGTCTGGGGCAGCATGGTGCTTTGGATGCTGTTTTTTGCCGTCTA[T/A]TCTGCGATCYGGCCAACTATTCCTATAGCTCCRGATATGTTRGGCCAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t1x2tixz