LOC558484

Ensembl ID:
ENSDARG00000077489
Human Orthologue:
LRFN2
Human Description:
leucine rich repeat and fibronectin type III domain containing 2 [Source:HGNC Symbol;Acc:21226]
Mouse Orthologue:
Lrfn2
Mouse Description:
leucine rich repeat and fibronectin type III domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3080 Nonsense F2 line generated During 2016
sa23611 Nonsense Mutation detected in F1 DNA During 2016
sa39263 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa3080
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114999 Nonsense 69 781 1 2
Genomic Location:
Chromosome 20 (position 87831)
KASP Assay ID:
554-3091.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTACCGTGGAGCTCCGGCTGGGKGGAAACTTCATCCTGCGAATCACA[C/T]AGCAGGACTTTGCCAACATGACAGACCTAGTGGACCTTACGCTCTCYCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114999 Nonsense 322 781 1 2
Genomic Location:
Chromosome 20 (position 88591)
KASP Assay ID:
2261-3788.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCCTGCGGTGCGATGCCATCGGAGATCCCATCCCTACCATACACT[G/A]GGTCACCCCTGAAGATCGATTGCTGGGAAACTCTTCTCGCACAGTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114999 Nonsense 373 781 1 2
Genomic Location:
Chromosome 20 (position 88743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCACTTGCATTGCAGCCAACCTGGCTGGCGAATCAACAGCTTCCGTG[G/T]AGCTGTCAATTATTCAGCTGCCTCACATAAGCAACGGCACAGGACAGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link