LOC558484

Ensembl ID:
ENSDARG00000077489
Human Orthologue:
LRFN2
Human Description:
leucine rich repeat and fibronectin type III domain containing 2 [Source:HGNC Symbol;Acc:21226]
Mouse Orthologue:
Lrfn2
Mouse Description:
leucine rich repeat and fibronectin type III domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3080 Nonsense F2 line generated During 2014
sa23611 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3080
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114999 Nonsense 69 781 1 2
Genomic Location:
Chromosome 20 (position 87831)
KASP Assay ID:
554-3091.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTACCGTGGAGCTCCGGCTGGGKGGAAACTTCATCCTGCGAATCACA[C/T]AGCAGGACTTTGCCAACATGACAGACCTAGTGGACCTTACGCTCTCYCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114999 Nonsense 322 781 1 2
Genomic Location:
Chromosome 20 (position 88591)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCCTGCGGTGCGATGCCATCGGAGATCCCATCCCTACCATACACT[G/A]GGTCACCCCTGAAGATCGATTGCTGGGAAACTCTTCTCGCACAGTTGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rsss17ea