AATK (2 of 2)

Ensembl ID:
ENSDARG00000077477
Description:
apoptosis-associated tyrosine kinase [Source:HGNC Symbol;Acc:21]
Human Orthologue:
AATK
Human Description:
apoptosis-associated tyrosine kinase [Source:HGNC Symbol;Acc:21]
Mouse Orthologue:
Aatk
Mouse Description:
apoptosis-associated tyrosine kinase Gene [Source:MGI Symbol;Acc:MGI:1197518]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22160 Nonsense Mutation detected in F1 DNA During 2014
sa11207 Nonsense Available for shipment Available now
sa19043 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111560 Nonsense 353 1657 10 14
Genomic Location:
Chromosome 12 (position 38064202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGCTGTTTGAGTTAGGGAATCAGCCGTACCGCCATTATTCAGACCGA[C/T]AGGTTCTCAGTTATGCTGTGAAGGATCAGCAATTGAAGCTGTCCAAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111560 Nonsense 981 1657 11 14
Genomic Location:
Chromosome 12 (position 38066425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCTCGGAGCAATTTGTGGATAYTGCAGWAGGAGAAACAAACTTAAAA[C/T]AAGAAAAAACRTTGCATCAAGATATATCTACAGCAGATCCAAAAACTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111560 Nonsense 1262 1657 11 14
Genomic Location:
Chromosome 12 (position 38067268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGGAGACAGATGTAGATGAATATCTTATGCCATCTACAAAGAAGAGT[G/T]AAAAAATCCCTGAACTGTCTGATCATTCAATCTCAAACCTTCCATCAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tid8wmky