PLA2R1 (1 of 2)

Ensembl ID:
ENSDARG00000077474
Description:
phospholipase A2 receptor 1, 180kDa [Source:HGNC Symbol;Acc:9042]
Human Orthologue:
PLA2R1
Human Description:
phospholipase A2 receptor 1, 180kDa [Source:HGNC Symbol;Acc:9042]
Mouse Orthologue:
Pla2r1
Mouse Description:
phospholipase A2 receptor 1 Gene [Source:MGI Symbol;Acc:MGI:102468]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21855 Essential Splice Site Available for shipment Available now
sa35032 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111091 Essential Splice Site 827 1470 16 30
Genomic Location (Zv9):
Chromosome 11 (position 11140722)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11091578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGATTTCCACAGGTGTGGAGCTGGTCAAGCCATACTGGTACAGCGACC[G/A]TAAGTAGTAAATTACTGCTCTACCAAAAGTTATGTGCTCTCAAGTTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111091 Nonsense 1160 1470 24 30
Genomic Location (Zv9):
Chromosome 11 (position 11156106)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11106962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGGGGGCAACACTCGTGAGCATCACAGACCCATTTCAGCAAGCTTA[T/A]CTGACCTTTCTGATCAACAGACTGGACGCCCCGCATTGGATCGGCTTATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link