polr1b

Ensembl ID:
ENSDARG00000077469
ZFIN ID:
ZDB-GENE-040426-1598
Description:
RNA polymerase I polypeptide B [Source:RefSeq peptide;Acc:NP_956812]
Human Orthologue:
POLR1B
Human Description:
polymerase (RNA) I polypeptide B, 128kDa [Source:HGNC Symbol;Acc:20454]
Mouse Orthologue:
Polr1b
Mouse Description:
polymerase (RNA) I polypeptide B Gene [Source:MGI Symbol;Acc:MGI:108014]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42280 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113305   None 150 None 3
ENSDART00000114741 Essential Splice Site 839 1132 14 15
ENSDART00000125769   None 150 None 4
Genomic Location (Zv9):
Chromosome 13 (position 42589665)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 41810714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGCTACATCAGTCTCAACACCGGCCAGAGCCATGTGTATTTCTACAA[G/A]TAAGGCATCACTTTTGTTATTGTTAATTTTGTTTAGTAATCAATATGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link