LOC100004230

Ensembl ID:
ENSDARG00000077465
Human Orthologue:
SORCS2
Human Description:
sortilin-related VPS10 domain containing receptor 2 [Source:HGNC Symbol;Acc:16698]
Mouse Orthologue:
Sorcs2
Mouse Description:
sortilin-related VPS10 domain containing receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1932289]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11642 Nonsense Available for shipment Available now
sa21038 Nonsense Mutation detected in F1 DNA During 2014
sa5436 Nonsense Mutation detected in F1 DNA During 2014
sa21039 Nonsense Available for shipment Available now
sa7079 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111278 Nonsense 424 1133 10 27
Genomic Location:
Chromosome 7 (position 41408230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGGTTCGTGGAGTCAAGGGCGTTTTCTTAGCCAATCAGAAAGTAGAT[G/T]GAAAAGTAATGACTCTCATCACCTACAACAAAGGCAGAGACTGGGAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111278 Nonsense 432 1133 10 27
Genomic Location:
Chromosome 7 (position 41408256)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTAGCCAATCAGAAAGTAGATGGAAAAGTAATGACTCTCATCACCTA[C/A]AACAAAGGCAGAGACTGGGAAGCGCTCGCTCCCCCTGCAACTGATATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111278 Nonsense 675 1133 17 27
Genomic Location:
Chromosome 7 (position 41428795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTACWTCTCTCACTTTCTGTGTGTGTTCTCAGTGACTATGGCTTTGAG[C/T]GAGCTCCCAGTCTCAGGTTAGAGGGGGATCGCTGTTATCCGGACTTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111278 Nonsense 777 1133 19 27
Genomic Location:
Chromosome 7 (position 41434440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGATTGTATTTGTTTCACTCCTCAGGGTGACACCAGCAGCACCAGGTA[T/A]CAGGTGGATTTAATGGACGGGGTCAGGGCTATATATGAGAACCTGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111278 Essential Splice Site 1064 1133 26 27
Genomic Location:
Chromosome 7 (position 41444173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGCTGAGGCCAGAGGAGAGCAGCCTAACGCGTCCCTGGCTGCGTTTCA[G/A]AAAACTGCCAGGCAGAAACGTCTACGCTCAGATGCACAACGAGAAGGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/smpyi29m