tubgcp5

Ensembl ID:
ENSDARG00000077442
ZFIN ID:
ZDB-GENE-050522-344
Description:
gamma-tubulin complex component 5 [Source:RefSeq peptide;Acc:NP_001018151]
Human Orthologue:
TUBGCP5
Human Description:
tubulin, gamma complex associated protein 5 [Source:HGNC Symbol;Acc:18600]
Mouse Orthologue:
Tubgcp5
Mouse Description:
tubulin, gamma complex associated protein 5 Gene [Source:MGI Symbol;Acc:MGI:2178836]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa842 Nonsense Available for shipment Available now
sa15200 Nonsense Available for shipment Available now
sa14709 Essential Splice Site Available for shipment Available now
sa675 Nonsense Available for shipment Available now
sa15685 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065122 Nonsense 82 1015 4 24
ENSDART00000144812 Nonsense 82 1015 4 24
Genomic Location:
Chromosome 6 (position 37575305)
KASP Assay ID:
554-0745.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGAAACTCATGGTTCACTCTGACTTGAGTAAAGCGGAGAGTTGGACA[C/T]GACTCACTGAAGAGTTTCTSACTTCGCCTCTTCCTAATACTGATGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065122 Nonsense 177 1015 7 24
ENSDART00000144812 Nonsense 177 1015 7 24
Genomic Location:
Chromosome 6 (position 37577286)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCTGAGGAGGAAAGCGAAGAAGACGACAGCCAGCAGYCCTTGAGCAGA[G/T]AGGATTCTGGGATACAGGTKGACAGAACGCCGCARGAGGACCACGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14709
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065122 Essential Splice Site 304 1015 10 24
ENSDART00000144812 Essential Splice Site 304 1015 10 24
Genomic Location:
Chromosome 6 (position 37579838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGCAAGGTGACTGTRAGGAATGATGTGGTGGTCAYGCATCTAACRAAW[G/A]TAAGTTTTKACCATTTCCCAAAACTCATCCAGRGGATTTGGTAGATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa675
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065122 Nonsense 579 1015 14 24
ENSDART00000144812 Nonsense 579 1015 14 24
Genomic Location:
Chromosome 6 (position 37584001)
KASP Assay ID:
554-0583.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAAAATCCATGCAGCTCCTCAAGAACCTGGACTGCAAGGAGACTGAA[C/T]AATCTGATGGCTCCTCTAGAGGTAATTTTTTTTTGTTTTATTTGATGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065122 Essential Splice Site 967 1015 22 24
ENSDART00000144812 Essential Splice Site 967 1015 22 24
Genomic Location:
Chromosome 6 (position 37596607)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTTCTCATCTTCTCTGACAGATGGCAGGCTGGTTTTGGGGCCTGGAAG[T/A]AAGTNNNAAAAAKCTTACATGTATCCYTATCTCACAGCTTTCACTTCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e93if2ln