B6E520_DANRE

Ensembl ID:
ENSDARG00000077437
Description:
Plexin A1b [Source:UniProtKB/TrEMBL;Acc:B6E520]
Human Orthologue:
PLXNA1
Human Description:
plexin A1 [Source:HGNC Symbol;Acc:9099]
Mouse Orthologue:
Plxna1
Mouse Description:
plexin A1 Gene [Source:MGI Symbol;Acc:MGI:107685]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14112 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109152 Nonsense 1095 1173 22 23
Genomic Location:
Chromosome 23 (position 34625577)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAGATCATCAYGCTTAACTGTTTGTCTTGCCTTCCTACAGGTATTAYT[C/A]AGACATCGCACGCATGCCTGCCATCAGTGATCAGGACATGAGTGCTTATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jsjb3001