B6E520_DANRE

Ensembl ID:
ENSDARG00000077437
Description:
Plexin A1b [Source:UniProtKB/TrEMBL;Acc:B6E520]
Human Orthologue:
PLXNA1
Human Description:
plexin A1 [Source:HGNC Symbol;Acc:9099]
Mouse Orthologue:
Plxna1
Mouse Description:
plexin A1 Gene [Source:MGI Symbol;Acc:MGI:107685]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37762 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37761 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37760 Nonsense Mutation detected in F1 DNA During 2016
sa14112 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109152 Essential Splice Site 283 1173 6 23
Genomic Location:
Chromosome 23 (position 34715581)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCTCTGTTGCGGTCAATATTGGACGTCACCCGTGCCACTTTAAAAAG[T/C]GAGTGTTTCTCTTCTATTCATATTTTGTGCCAAACTTCCACCACATTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109152 Essential Splice Site 575 1173 11 23
Genomic Location:
Chromosome 23 (position 34688292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCAGATGGACAACCTGGAGTCCAGAGTCGCTCTCGAGTGCAAAGAAG[G/A]TGAGCTTTTGGTTATTTTTAAGTCAGGTCTCATTTGTGGCCTGCAGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109152 Nonsense 1024 1173 21 23
Genomic Location:
Chromosome 23 (position 34626382)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTCCATCCTCATTCCTGTGTGTTTTCTATATTTTACAGTTTGCCGT[T/A]AAGGTTCTGGGTGAATGTGATAAAGAATCCTCAGTTTGTGTTTGACATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109152 Nonsense 1095 1173 22 23
Genomic Location:
Chromosome 23 (position 34625577)
KASP Assay ID:
2261-8061.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAGATCATCAYGCTTAACTGTTTGTCTTGCCTTCCTACAGGTATTAYT[C/A]AGACATCGCACGCATGCCTGCCATCAGTGATCAGGACATGAGTGCTTATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link