KIAA2018

Ensembl ID:
ENSDARG00000077431
Description:
KIAA2018 [Source:HGNC Symbol;Acc:30494]
Human Orthologue:
KIAA2018
Human Description:
KIAA2018 [Source:HGNC Symbol;Acc:30494]
Mouse Orthologue:
Gm608
Mouse Description:
predicted gene 608 Gene [Source:MGI Symbol;Acc:MGI:2685454]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8037 Nonsense Mutation detected in F1 DNA During 2014
sa18018 Nonsense Available for shipment Available now
sa24492 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Nonsense 176 2104 5 11
Genomic Location:
Chromosome 24 (position 21803806)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAAGCAAAGTCTCTATTCCTCCTAGTCCAGTTTCCAATCTCGATAAA[C/T]AACCATCAAATGCTGYAACAKTCCAACCATCATGCGATATTTCATTGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18018
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Nonsense 381 2104 7 11
Genomic Location:
Chromosome 24 (position 21804613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGATATATTCGGCTGTTGTGCCRTGCCCTCAGGCAGCAGTAGCACAA[C/T]AGTCYTCAATTTTATCTGTSCCAGCCATTGTATCACAAGCTTTAGTAGTM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Nonsense 1061 2104 10 11
Genomic Location:
Chromosome 24 (position 21807110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACCTTTGGCAGGAGGTTCAGGTGGCAGAGGGTTTTCTGTTGCATCGT[T/A]GCTTCCAGCAGGCCACAACATCAGCGCTTCTTCAAGTACATTTGGTGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1fgso8ll