KIAA2018

Ensembl ID:
ENSDARG00000077431
Description:
KIAA2018 [Source:HGNC Symbol;Acc:30494]
Human Orthologue:
KIAA2018
Human Description:
KIAA2018 [Source:HGNC Symbol;Acc:30494]
Mouse Orthologue:
Gm608
Mouse Description:
predicted gene 608 Gene [Source:MGI Symbol;Acc:MGI:2685454]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44127 Splice Site Mutation detected in F1 DNA During 2016
sa18018 Nonsense Available for shipment Available now
sa44128 Nonsense Mutation detected in F1 DNA During 2016
sa24492 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Splice Site None 2104 None 11
Genomic Location (Zv9):
Chromosome 24 (position 21803852)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21050981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACAACCATCAAATGCTGTAACAGTCCAACCATCATGCGATATTTCAT[T/A]GGGCACCGGCCAGACTTTTGGTATTACGAATGGAGCACCAGTAAACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18018
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Nonsense 381 2104 7 11
Genomic Location (Zv9):
Chromosome 24 (position 21804613)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21051742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGATATATTCGGCTGTTGTGCCRTGCCCTCAGGCAGCAGTAGCACAA[C/T]AGTCYTCAATTTTATCTGTSCCAGCCATTGTATCACAAGCTTTAGTAGTM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Nonsense 942 2104 10 11
Genomic Location (Zv9):
Chromosome 24 (position 21806753)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21053882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCAGGCATCATTTGATGCAACTTCAACTCCAGATTCAGACACTTCTT[T/A]GTCAACTCAACCTGTTCCCCTTTCAGAAACATCAAGGATTTCAGACCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Nonsense 1061 2104 10 11
Genomic Location (Zv9):
Chromosome 24 (position 21807110)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21054239
KASP Assay ID:
2261-8691.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACCTTTGGCAGGAGGTTCAGGTGGCAGAGGGTTTTCTGTTGCATCGT[T/A]GCTTCCAGCAGGCCACAACATCAGCGCTTCTTCAAGTACATTTGGTGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link