si:ch73-160p19.2

Ensembl ID:
ENSDARG00000077426
ZFIN ID:
ZDB-GENE-091204-308
Human Orthologue:
ZBTB38
Human Description:
zinc finger and BTB domain containing 38 [Source:HGNC Symbol;Acc:26636]
Mouse Orthologue:
Zbtb38
Mouse Description:
zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39213 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39213
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111152 Nonsense 802 1053 4 5
ENSDART00000143327 Nonsense 878 942 2 2
Genomic Location (Zv9):
Chromosome 18 (position 39539915)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41209412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCAAAGTAACCGTCCAGAGGAGAGTATTGGAAGTCCAAGTTTGCGGT[T/A]GAGGGCAGAAGTCACAACCTCAGTTAGAGAAAAAGAAACATATGATGACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: A large-scale genome-wide association study of Asian populations uncovers genetic factors influencing eight quantitative traits. (View Study)
  • Height: Common variants in the GDF5-UQCC region are associated with variation in human height. (View Study)
  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)
  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Height: Meta-analysis of genome-wide scans for human adult stature identifies novel Loci and associations with measures of skeletal frame size. (View Study)
  • Prion diseases: Genome-wide association study in multiple human prion diseases suggests genetic risk factors additional to PRNP. (View Study)
  • Prostate cancer: Seven prostate cancer susceptibility loci identified by a multi-stage genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link