ENSDARG00000077415

Ensembl ID:
ENSDARG00000077415

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24073 Nonsense Available for shipment Available now
sa43767 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078241 Nonsense 86 296 1 3
Genomic Location (Zv9):
Chromosome 22 (position 8678912)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 8624682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAAAACCACAGACACTGGACTTTATAAAGCAGAGATCAACCACAATTA[T/A]GGGACTTCAGAGTGGTTATTCAATGTTACTGTCAATGGTGAGGATATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078241 Nonsense 176 296 2 3
Genomic Location (Zv9):
Chromosome 22 (position 8675530)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 8621300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGCTGGACTCTACGACTGGATCAGTAACAATAAGAAACACAGCAAGT[G/T]AACATGTTGGAGTCTATAAACTGAAGATTATCAGCAGCACTGGGACCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link