NP_001122261.1

Ensembl ID:
ENSDARG00000077414
Description:
hypothetical protein LOC794943 [Source:RefSeq peptide;Acc:NP_001122261]
Mouse Orthologues:
Csprs, Gm7592, Gm7609
Mouse Descriptions:
component of Sp100-rs Gene [Source:MGI Symbol;Acc:MGI:1891441]
predicted gene 7592 Gene [Source:MGI Symbol;Acc:MGI:3644077]
predicted pseudogene 7609 Pseudogene [Source:MGI Symbol;Acc:MGI:3644536]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2380 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa2380
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125594 Nonsense 74 323 1 2
Genomic Location (Zv9):
Chromosome 7 (position 21495392)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20085828
KASP Assay ID:
554-3207.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGCGCTGGTTTACTTTGCGCTCTGCTTCAGCTTCTACTTACAAAACTA[T/A]CTGAATGCGGCCACCACGGCCACCACATGCACGGYGCTAATAAGAGGWCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link