myo9b

Ensembl ID:
ENSDARG00000077410
ZFIN ID:
ZDB-GENE-030131-938
Human Orthologue:
MYO9B
Human Description:
myosin IXB [Source:HGNC Symbol;Acc:7609]
Mouse Orthologue:
Myo9b
Mouse Description:
myosin IXb Gene [Source:MGI Symbol;Acc:MGI:106624]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19821 Nonsense Mutation detected in F1 DNA During 2014
sa8631 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16154 Essential Splice Site Available for shipment Available now
sa15461 Essential Splice Site Available for shipment Available now
sa17368 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088040 Nonsense 334 2227 4 56
ENSDART00000131590 None None 678 None 16
ENSDART00000144807 Nonsense 334 998 5 22

The following transcripts of ENSDARG00000077410 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 37448755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTCAACGCAAATTCCTTGTCTGCTTGTTATCTGACCTACAGGAATTA[T/A]CATGTTTTTTATTACCTTTTGATTGGCGCCTCAGAGGAGGAGAGAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088040 Essential Splice Site 417 2227 None 56
ENSDART00000131590 None None 678 None 16
ENSDART00000144807 Essential Splice Site 399 998 None 22

The following transcripts of ENSDARG00000077410 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 37448213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAWCAGGCCATGGAGATGGTCGGTTTTCTGCCTCCAACCAAAAAGCAG[T/C]AAGTTTATTTTTTGNATTTAGATTTTTCTCTTTAGTCTGCATCCTAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088040 Essential Splice Site 904 2227 20 56
ENSDART00000131590 None None 678 None 16
ENSDART00000144807 Essential Splice Site 847 998 18 22

The following transcripts of ENSDARG00000077410 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 37430807)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAGCAGAACCTTTCTTTGTTCGCTGTATCAGATCAAATGGGGATAAG[G/A]TATGGCGGAGAGCTKTYGTTTGAAGATTTGTRAYAAATCTGTGGAATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088040 Essential Splice Site 941 2227 21 56
ENSDART00000131590 None None 678 None 16
ENSDART00000144807 Essential Splice Site 884 998 19 22

The following transcripts of ENSDARG00000077410 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 37430589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCGTTCGGATTAGAAGGTCTGGATATGGAGCCAAATTCACCTTTAGGG[T/A]AATGTACTGAAATACTTTTTAAAATGTGTWACRTTTCATTARGGCTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088040 Nonsense 1077 2227 25 56
ENSDART00000131590 None None 678 None 16
ENSDART00000144807 None None 998 None 22

The following transcripts of ENSDARG00000077410 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 37426499)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATKTAACACTTTTACAGTATTTATAATTTATTTGTGACCMTCTTCACMCT[C/T]AAATGTATTGCAAATWYGTTTGGGAAGCTAAATAAATGATAATMGAGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7v4xiqq7