cby1

Ensembl ID:
ENSDARG00000077409
ZFIN ID:
ZDB-GENE-030131-5074
Description:
protein chibby homolog 1 [Source:RefSeq peptide;Acc:NP_001003838]
Human Orthologues:
CBY1, CBY3
Human Descriptions:
chibby homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:1307]
chibby homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:33278]
Mouse Orthologues:
Cby1, Cby3
Mouse Descriptions:
chibby homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920989]
chibby homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1923903]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12790 Essential Splice Site Available for shipment Available now
sa22078 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109541 None None 125 1 4
ENSDART00000134726 Essential Splice Site None 85 None 4
ENSDART00000148011 Essential Splice Site None 125 None 5
Genomic Location:
Chromosome 12 (position 20285047)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGTTAGCGCGAATCTCGAAGCTAACGGTAGTCTCACCTCCACGTTTGG[T/C]GAGTCACTTTGAGATCAAGATGAACNNNNNTGTCTTTTGTTCAACTTTAGTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109541 Nonsense 81 125 3 4
ENSDART00000134726 None None 85 None 4
ENSDART00000148011 Nonsense 81 125 4 5
Genomic Location:
Chromosome 12 (position 20286180)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAAATGTGTCAGGAAAAGAAGTTCAGCGACTGAAGAAGAGGAATCTA[C/T]AGTTAGAGGAGGAGAATAATCTGCTCAGGCTGAAGATTGAAGTTCTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/22s6e2zz