Q6PFP4_DANRE

Ensembl ID:
ENSDARG00000077405
Description:
LOC402866 protein [Source:UniProtKB/TrEMBL;Acc:Q6PFP4]
Human Orthologues:
AC002365.1, AC003980.1, AC006062.1, AC006999.1, AC007379.1, AC008162.1, AC008573.1, AC008794.1, AC010133.1, AC011503.2, AC012596.1, AC016595.1, AC018553.1, AC022409.1, AC022486.1, AC023481.1, AC067941.1, AC091492.1, AC092485.1, AC097714.1, AC116351.3, AC145210.1, AL121899.1, AL138690.1, AL159986.1, AL357512.1, RBM25, TCHH, TRAF3IP1, ZC3H13
Human Descriptions:
RNA binding motif protein 25 [Source:HGNC Symbol;Acc:23244]
TNF receptor-associated factor 3 interacting protein 1 [Source:HGNC Symbol;Acc:17861]
trichohyalin [Source:HGNC Symbol;Acc:11791]
zinc finger CCCH-type containing 13 [Source:HGNC Symbol;Acc:20368]
Mouse Orthologues:
Gm10563, Rbm25, Tchh, Traf3ip1, Zc3h13
Mouse Descriptions:
predicted gene 10563 Gene [Source:MGI Symbol;Acc:MGI:3642630]
RNA binding motif protein 25 Gene [Source:MGI Symbol;Acc:MGI:1914289]
TRAF3 interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921269]
trichohyalin Gene [Source:MGI Symbol;Acc:MGI:2177944]
zinc finger CCCH type containing 13 Gene [Source:MGI Symbol;Acc:MGI:1914552]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3565 Nonsense Available for shipment Available now
sa44059 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
hu3565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102441 Nonsense 128 757 5 9
ENSDART00000111126 Nonsense 122 679 4 8
Genomic Location (Zv9):
Chromosome 23 (position 44928416)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45584532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGAGTCGACTAAAGTGGAAAAACAAGAAGAAGAAGAAAGCAGAAAAT[C/T]AGACTGAAGTGAAGAAACCCCCAAAATCAGCTAAAGATCCAGTGTCGAAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa44059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102441   None 757 None 9
ENSDART00000111126 Nonsense 593 679 8 8
Genomic Location (Zv9):
Chromosome 23 (position 44924361)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45588587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGCGAGTCTGAAAAGAGAGAGGCAGGAAAGAGCGAGTCTGAAATGAAA[G/T]AGGCAAGAAAGAACGAGTCAGAAAAGGAAGAGGCCAGAAAGCGAGAGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hair color: Web-based, participant-driven studies yield novel genetic associations for common traits. (View Study)
  • Hair morphology: Common variants in the trichohyalin gene are associated with straight hair in Europeans. (View Study)
  • Iris characteristics: GWAS findings for human iris patterns: associations with variants in genes that influence normal neuronal pattern development. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link