ncoa3

Ensembl ID:
ENSDARG00000077404
ZFIN ID:
ZDB-GENE-051107-8
Description:
SRC3 [Source:UniProtKB/TrEMBL;Acc:Q1L661]
Human Orthologue:
NCOA3
Human Description:
nuclear receptor coactivator 3 [Source:HGNC Symbol;Acc:7670]
Mouse Orthologue:
Ncoa3
Mouse Description:
nuclear receptor coactivator 3 Gene [Source:MGI Symbol;Acc:MGI:1276535]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21881 Nonsense Available for shipment Available now
sa35062 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10250 Nonsense Available for shipment Available now
sa35063 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110621 Nonsense 28 1497 1 22
Genomic Location (Zv9):
Chromosome 11 (position 19085896)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18503210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTGTGCTCGGACAGGAAGCGCAAACTCTCCACATGTGACACACCAGGA[C/T]AAGGGTGAGACTTTTTTTTTTGTTTGAATGAATGCATTATTGTTGGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110621 Essential Splice Site 116 1497 3 22
Genomic Location (Zv9):
Chromosome 11 (position 19089442)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18506756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTCAAGGGGTCATCGACAAGGACCATCTGGGCCCTCTGTTGCTGCAG[G/A]TTAGATTAGAGACCTAAGGGTCACCAGAAGAACATTTGCTCATTTCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110621 Nonsense 311 1497 7 22
Genomic Location (Zv9):
Chromosome 11 (position 19096028)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18513342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTCCTGCATCGCAGYGAGGGTCAGCCCTGGTCATACAAGAGACATTA[T/A]CATGAAGGTATGTGGACAGACACTTGCAGGGATTTTCTTCTCATTTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35063
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110621 Nonsense 844 1497 10 22
Genomic Location (Zv9):
Chromosome 11 (position 19101910)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18519224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCAAGCCAAAGCTGGAGGAGCTTGAAGCAAGAGGGGCATCTGGAGGG[C/T]AGGGGGCAGGGGTCACGACCTCCAGTTCTAGTAACCAGGAGAGCAAGGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link