col8a1a

Ensembl ID:
ENSDARG00000077403
ZFIN ID:
ZDB-GENE-070912-274
Description:
collagen, type VIII, alpha 1a [Source:RefSeq peptide;Acc:NP_001135846]
Human Orthologue:
COL8A1
Human Description:
collagen, type VIII, alpha 1 [Source:HGNC Symbol;Acc:2215]
Mouse Orthologue:
Col8a1
Mouse Description:
collagen, type VIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88463]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6114 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13665 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102981 Essential Splice Site 72 711 3 3
Genomic Location:
Chromosome 9 (position 31134163)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTAATGACAYATATTTTTATACCTTGTCCTGAATTTKTCTCTTGCAT[A/C]GGTGAGACCATTCCCAGAGGTGAGCAGGGTGTTCAAGGTCAGCCTGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102981 Nonsense 123 711 3 3
Genomic Location:
Chromosome 9 (position 31134319)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTATCCAAGGCCCTCCTGGAAAGCCAGGACCTCCTGGTCCTCCAGGATA[T/A]CCTGGAATTGGTAAGCCAGGAATGTCAGGTATGCCTGGTAAAGCAGGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/auikk7r1