col8a1a

Ensembl ID:
ENSDARG00000077403
ZFIN ID:
ZDB-GENE-070912-274
Description:
collagen, type VIII, alpha 1a [Source:RefSeq peptide;Acc:NP_001135846]
Human Orthologue:
COL8A1
Human Description:
collagen, type VIII, alpha 1 [Source:HGNC Symbol;Acc:2215]
Mouse Orthologue:
Col8a1
Mouse Description:
collagen, type VIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88463]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6114 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13665 Nonsense Available for shipment Available now
sa34670 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102981 Essential Splice Site 72 711 3 3
Genomic Location:
Chromosome 9 (position 31134163)
KASP Assay ID:
554-3737.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTAATGACAYATATTTTTATACCTTGTCCTGAATTTKTCTCTTGCAT[A/C]GGTGAGACCATTCCCAGAGGTGAGCAGGGTGTTCAAGGTCAGCCTGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102981 Nonsense 123 711 3 3
Genomic Location:
Chromosome 9 (position 31134319)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTATCCAAGGCCCTCCTGGAAAGCCAGGACCTCCTGGTCCTCCAGGATA[T/A]CCTGGAATTGGTAAGCCAGGAATGTCAGGTATGCCTGGTAAAGCAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102981 Nonsense 613 711 3 3
Genomic Location:
Chromosome 9 (position 31135789)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCACACCAATAGTGCTTGACAAACTATTGTACAATGGACGTCAGAATTA[C/A]AACCCTCAGACAGGTGTGTTCACCTGTGACCTCCCAGGTGTTTACTATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link