si:ch73-205c16.2

Ensembl ID:
ENSDARG00000077400
ZFIN ID:
ZDB-GENE-100922-245
Human Orthologue:
RBM10
Human Description:
RNA binding motif protein 10 [Source:HGNC Symbol;Acc:9896]
Mouse Orthologue:
Rbm10
Mouse Description:
RNA binding motif protein 10 Gene [Source:MGI Symbol;Acc:MGI:2384310]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32421 Essential Splice Site Available for shipment Available now
sa43901 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37584 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111456 Essential Splice Site 152 666 None 20
ENSDART00000133906   None 199 None 4
ENSDART00000136805 Essential Splice Site 151 266 None 8
ENSDART00000111456 Essential Splice Site 152 666 None 20
ENSDART00000133906   None 199 None 4
ENSDART00000136805 Essential Splice Site 151 266 None 8
Genomic Location (Zv9):
Chromosome 23 (position 923890)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 871030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTCAACTTAAGCTCCTCCCCCCAGCCCTCTGAGGCGGCCAATGACAG[T/C]AAGTCTTAAAGTCTGCATGAACTGTTTCGTATTGTAATTTAAGTTTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111456 Essential Splice Site 152 666 None 20
ENSDART00000133906   None 199 None 4
ENSDART00000136805 Essential Splice Site 151 266 None 8
ENSDART00000111456 Essential Splice Site 152 666 None 20
ENSDART00000133906   None 199 None 4
ENSDART00000136805 Essential Splice Site 151 266 None 8
Genomic Location (Zv9):
Chromosome 23 (position 923890)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 871030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTCAACTTAAGCTCCTCCCCCCAGCCCTCTGAGGCGGCCAATGACAG[T/C]AAGTCTTAAAGTCTGCATGAACTGTTTCGTATTGTAATTTAAGTTTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111456 Nonsense 578 666 18 20
ENSDART00000133906 Nonsense 159 199 4 4
ENSDART00000136805   None 266 None 8
Genomic Location (Zv9):
Chromosome 23 (position 907270)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 854410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCAGGCTCTGCTGGCGGGCTGCAGTGTAGAGACGGACAGCGAGGAC[G/T]AGAGCTCAGAGAAGCAGGAGCGTCTGACGGACTGGTGTAAACTGGCCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link