obsl1b

Ensembl ID:
ENSDARG00000077388
ZFIN ID:
ZDB-GENE-050809-29
Description:
Novel protein similar to vertebrate obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (
Human Orthologue:
OBSL1
Human Description:
obscurin-like 1 [Source:HGNC Symbol;Acc:29092]
Mouse Orthologue:
Obsl1
Mouse Description:
obscurin-like 1 Gene [Source:MGI Symbol;Acc:MGI:2138628]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7206 Nonsense Mutation detected in F1 DNA During 2014
sa15355 Nonsense Available for shipment Available now
sa10142 Nonsense Available for shipment Available now
sa8353 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112542 None None 888 None 13
ENSDART00000138938 None None 232 None 4
ENSDART00000141117 None None 113 None 2
ENSDART00000144573 Nonsense 226 798 2 7
Genomic Location:
Chromosome 9 (position 42853730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGACATGAAGATGAAGGCAACCGTAATGGATACACKAACGGCCACTGG[A/T]AAGCACATCAGGGGAAACAAAGAAGTGGTAGACAAGTTGCKACCAGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112542 Nonsense 139 888 3 13
ENSDART00000138938 None None 232 None 4
ENSDART00000141117 None None 113 None 2
ENSDART00000144573 None None 798 None 7
ENSDART00000112542 Nonsense 139 888 3 13
ENSDART00000138938 None None 232 None 4
ENSDART00000141117 None None 113 None 2
ENSDART00000144573 None None 798 None 7
Genomic Location:
Chromosome 9 (position 42838513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGATTGAYGGAAMTGAGCATTTCACCTGTGAAGAAGAAGGGGCWTTC[A/T]GATCTCTGATTGTCCTRAATGCTGAGTTGAGAGACTCCGGAGAGTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10142
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112542 Nonsense 139 888 3 13
ENSDART00000138938 None None 232 None 4
ENSDART00000141117 None None 113 None 2
ENSDART00000144573 None None 798 None 7
ENSDART00000112542 Nonsense 139 888 3 13
ENSDART00000138938 None None 232 None 4
ENSDART00000141117 None None 113 None 2
ENSDART00000144573 None None 798 None 7
Genomic Location:
Chromosome 9 (position 42838513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGATTGAYGGAAMTGAGCATTTCACCTGTGAAGAAGAAGGGGCWTTC[A/T]GATCTCTGATTGTCCTRAATGCTGAGTTGAGAGACTCCGGAGAGTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112542 Missense 888 888 13 13
ENSDART00000138938 Essential Splice Site 229 232 3 4
ENSDART00000141117 None None 113 None 2
ENSDART00000144573 None None 798 None 7
Genomic Location:
Chromosome 9 (position 42819857)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTTTATCACAGGGAGAACCAAAAGCACTGCRCAGCTACTTGTCAGAA[G/A]TAAGTCAWRTAATAGGTTATCTACAGTTGAAGTTTTTTTTTTTTTTATTN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wxwc11be