si:ch211-195h3.2

Ensembl ID:
ENSDARG00000077367
ZFIN ID:
ZDB-GENE-081105-186
Description:
Novel protein similar to vertebrate netrin G2 (NTNG2) [Source:UniProtKB/TrEMBL;Acc:B0UX66]
Human Orthologue:
NTNG2
Human Description:
netrin G2 [Source:HGNC Symbol;Acc:14288]
Mouse Orthologue:
Ntng2
Mouse Description:
netrin G2 Gene [Source:MGI Symbol;Acc:MGI:2159341]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34335 Nonsense Mutation detected in F1 DNA During 2017
sa21214 Nonsense Available for shipment Available now
sa18661 Nonsense Available for shipment Available now
sa18579 Nonsense Available for shipment Available now
sa34336 Nonsense Mutation detected in F1 DNA During 2017
sa34337 Nonsense Mutation detected in F1 DNA During 2017
sa10911 Nonsense Available for shipment Available now
sa18909 Nonsense Mutation detected in F1 DNA During 2017
sa34338 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 61 1256 1 13
ENSDART00000132492 Nonsense 53 343 1 3
ENSDART00000138101   None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12510839)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11955602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACGCTTGCCAGCCCAAACCCATGTCCATGAAGGAGTACATGCAGATT[A/T]GAGTGGAGCCTCCCGATATCACATGTGGAAACCCACCGGAGAGATACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21214
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 108 1256 2 13
ENSDART00000132492 Nonsense 100 343 2 3
ENSDART00000138101   None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12533702)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11978465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCACCAAAGAACTGGCTCATCCTCCAGAGCTGATGCAAGACAGCGAG[C/T]GAACCGGACTCATCACCTACTGGCAGACGGTAACATGGAGTCGATATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 135 1256 2 13
ENSDART00000132492 Nonsense 127 343 2 3
ENSDART00000138101   None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12533785)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11978548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGGAGTCGATATCCTGMGCCTCTTCTGGCCAACATATCCTTATCCTG[G/A]AACAAAAGCCTTGAGTTAACAGATGACATCCAGATATCCTTTGAGTATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 505 1256 8 13
ENSDART00000132492   None 343 None 3
ENSDART00000138101   None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12608186)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12052949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MAGCAACTGACACCGTCTTTGCAACAACTGCCTTYGGTGCAAGCAATCCA[C/T]GATCTGCTCTTCCTGAGGTTACTGATGCACTTGCTTCATCATCTGATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 531 1256 8 13
ENSDART00000132492   None 343 None 3
ENSDART00000138101   None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12608264)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12053027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTGCTTCATCATCTGATGCCACTGCAACAACACTTAATATGGTCATC[C/T]GAGCAACCATGGCAACAACACCTTCTGTAACCATGGCAACTTCTGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 695 1256 8 13
ENSDART00000132492   None 343 None 3
ENSDART00000138101   None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12608757)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12053520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGAAGTCGTCATGAGAAGTGAAGAAACAGTCAGCACTGACGTAGACT[C/A]GCCTACATCGGGTGTAACTCTTCTGACAGGTGAGCCAGTGCCTGATGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 994 1256 8 13
ENSDART00000132492   None 343 None 3
ENSDART00000138101   None 156 None 3
ENSDART00000114432 Nonsense 994 1256 8 13
ENSDART00000132492   None 343 None 3
ENSDART00000138101   None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12609653)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12054416
KASP Assay ID:
2260-0236.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCTGATCGTAAACCTTYATCCAAAGTAGGRGAAAACAGCGAAGAGTCC[A/T]ARGAATCGAAAACAGCTTTAAATTCGGAGAARAAAGATAAAGATGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 994 1256 8 13
ENSDART00000132492   None 343 None 3
ENSDART00000138101   None 156 None 3
ENSDART00000114432 Nonsense 994 1256 8 13
ENSDART00000132492   None 343 None 3
ENSDART00000138101   None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12609653)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12054416
KASP Assay ID:
2260-0236.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTGATCGTAAACCTTTATCCAAAGTAGGAGAAAACAGCGAAGAGTCC[A/T]AGGAATCGAAAACAGCTTTAAATTCGGAGAAGAAAGATAAAGATGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 1048 1256 9 13
ENSDART00000132492   None 343 None 3
ENSDART00000138101   None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12611361)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12056124
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAAAAGAGCAAAGAAGCCAAGGAGGAAAAGAAAGAGAAAGAAAAGCAC[A/T]AAGAAAAGGAGTTTAAAGAGTATGAGAAAAAAGGTATACACATAGTGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link