si:ch211-247j9.2

Ensembl ID:
ENSDARG00000077364
ZFIN ID:
ZDB-GENE-091117-28
Human Orthologue:
MAPK9
Human Description:
mitogen-activated protein kinase 9 [Source:HGNC Symbol;Acc:6886]
Mouse Orthologue:
Mapk9
Mouse Description:
mitogen-activated protein kinase 9 Gene [Source:MGI Symbol;Acc:MGI:1346862]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23984 Nonsense Available for shipment Available now
sa37352 Nonsense Available for shipment Available now
sa18329 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23984
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112550 Nonsense 172 421 6 12

The following transcripts of ENSDARG00000077364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31122287)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32321757
KASP Assay ID:
2261-5832.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTGGTGAAGTCCGACTGCACTTTAAAGATCTTAGACTTTGGACTGGCC[A/T]GAACCGCCTGCACTAATTTTATGATGACACCTTATGTAGTGACCAGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112550 Nonsense 322 421 9 12

The following transcripts of ENSDARG00000077364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31119926)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32319396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCGTATCTCTGTGCAGGAGGCTCTTAATCACCCCTACATTCATGTGTG[G/A]TACGACCCAGCTGAGGCTGATGCGGTCAGTGCACCTCTGTCTATCTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112550 Nonsense 334 421 10 12

The following transcripts of ENSDARG00000077364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31119760)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32319230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGGGCCTTGAATTTGTACTGATTRTTTTATGTGTTCWGCCTCCTCCA[C/T]AGATCTCAGACAAGCAGCTTGAGGAGCGSGAACACAGCAYYGAGCAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link