BPTF

Ensembl ID:
ENSDARG00000077361
Description:
bromodomain PHD finger transcription factor [Source:HGNC Symbol;Acc:3581]
Human Orthologues:
AC005829.1, AC103810.3, BPTF
Human Description:
bromodomain PHD finger transcription factor [Source:HGNC Symbol;Acc:3581]
Mouse Orthologue:
Bptf
Mouse Description:
bromodomain PHD finger transcription factor Gene [Source:MGI Symbol;Acc:MGI:2444008]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13237 Essential Splice Site Available for shipment Available now
sa7544 Missense Mutation detected in F1 DNA During 2014
sa12837 Nonsense Available for shipment Available now
sa20012 Nonsense Available for shipment Available now
sa20011 Nonsense Mutation detected in F1 DNA During 2014
sa20010 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Essential Splice Site 942 2725 14 36
Genomic Location:
Chromosome 3 (position 25506754)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCAGCAGGCCACATGGGTGAAGTACACTTTCCCCATCAAACACCAGG[T/C]ACGTTAGAGCACTTGCAAGCTATGTGTTTCTGTTAAAAAAATAMCATCYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Missense 1093 2725 17 36
Genomic Location:
Chromosome 3 (position 25505836)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARCAATGCTTTTGGCATGATGTTGTAAAYGTTAGTGAAGGCTTTTTACAA[C/G]GCACAGCATACAAGAAATTAAAGCCATCAAAACTTGATGGCCTTTTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12837
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Nonsense 1348 2725 17 36
Genomic Location:
Chromosome 3 (position 25505069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAGGAACCAGTAAAGTCACTAATGAATGGTGACGCCASTCAAGAGTG[T/A]CTTAAAGAATGGACTAATAGCACGATTCCTCAGGTGAATTTGGATGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Nonsense 1573 2725 17 36
Genomic Location:
Chromosome 3 (position 25504396)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAAAATCTATGACTGTAAGTCATGAATATTCCACCAGGGACAGAGTA[C/T]GACTATTAAAGTTTTCTCGCACCAAGAAAACGAGGTCGGGAACAGCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Nonsense 2003 2725 25 36
Genomic Location:
Chromosome 3 (position 25499225)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCCCCACACCAAACCAACCCCAGACCCCACAGACGCCCGCTTCTCCA[C/T]GACCACAGCAGGGTCAGGTCAAACTCACTCTGGCCCAGCTCACACAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Essential Splice Site 2478 2725 30 36
Genomic Location:
Chromosome 3 (position 25491976)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGAAGAAAAGAGCTCTGCTGGATAAGGAACTGCAGCTGCAAGTGCAG[G/A]TAAGCAACAGCAAAAGACCAAACTTTCTCTGATTTACACTGATCTGAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lung adenocarcinoma: A genome-wide association study identifies two new susceptibility loci for lung adenocarcinoma in the Japanese population. (View Study)
  • Lung cancer: Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ayiqj1kk