rerea

Ensembl ID:
ENSDARG00000077353
ZFIN ID:
ZDB-GENE-060718-1
Human Orthologue:
RERE
Human Description:
arginine-glutamic acid dipeptide (RE) repeats [Source:HGNC Symbol;Acc:9965]
Mouse Orthologue:
Rere
Mouse Description:
arginine glutamic acid dipeptide (RE) repeats Gene [Source:MGI Symbol;Acc:MGI:2683486]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8509 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2014
sa10433 Essential Splice Site Available for shipment Available now
sa9631 Nonsense Available for shipment Available now
sa13495 Nonsense Available for shipment Available now
sa24320 Nonsense Mutation detected in F1 DNA During 2014
sa1112 Nonsense F2 line generated During 2014
sa24321 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111345 Essential Splice Site 108 1531 1 21
ENSDART00000135130 None None 1390 None 19
ENSDART00000142085 Splice Site None 131 None 3
Genomic Location:
Chromosome 23 (position 23114436)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATCACTTCCTTCATTACGGAGGACGACATTGTTTACAGACCTGGTGG[T/C]GAGTTATGCTTGTAWAATCKTTATTTAGTATGTCTGGATATCAAAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111345 Essential Splice Site 199 1531 5 21
ENSDART00000135130 Essential Splice Site 68 1390 3 19
ENSDART00000142085 None None 131 None 3
Genomic Location:
Chromosome 23 (position 23170870)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAGTGTATTCACACTGTGACACTGATTTGTTTGCTCTATTTCTTTGC[A/C]GGGGGAAATGTAACATTTCACACTTTTCTGACATATTCGCTGCMAGRGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111345 Nonsense 225 1531 5 21
ENSDART00000135130 Nonsense 94 1390 3 19
ENSDART00000142085 None None 131 None 3
Genomic Location:
Chromosome 23 (position 23170950)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACATATTCGCTGCMAGRGAGTTCAAAGCAAGAATCGACTCTTTCTTCTA[C/A]ATCTTAGGATATAACCCAGAAACCAGGTAAGCCTTTACTGACTTCAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111345 Nonsense 496 1531 13 21
ENSDART00000135130 Nonsense 365 1390 11 19
ENSDART00000142085 None None 131 None 3
Genomic Location:
Chromosome 23 (position 23212426)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGAGAACATCTTGCTGTGCAMCGACTGCCGGATCCATTTTAAGAAGTA[C/A]GGCGAACTACCACCCATTGAGAAGCCTGTAGACCCGCCACCGWTTATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111345 Nonsense 522 1531 13 21
ENSDART00000135130 Nonsense 391 1390 11 19
ENSDART00000142085 None None 131 None 3
Genomic Location:
Chromosome 23 (position 23212502)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAGACCCGCCACCGTTTATGTTCAAACCTGTCAAAGAGGAAGACGAT[G/T]GACTCAGTGGGAAGCATAGCATGAGGACTCGACGGAATCGCGGCTCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1112
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111345 Nonsense 705 1531 16 21
ENSDART00000135130 Nonsense 574 1390 14 19
ENSDART00000142085 None None 131 None 3
Genomic Location:
Chromosome 23 (position 23213977)
KASP Assay ID:
554-1014.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCCCAGCAGCAGATCCTTCAGGGCCAGCACCCTCCAGTCATCCAGTG[C/A]CAGACAGGGACTTTACCCCCAGCCCCTCCACCGGCAGCTGCAGCTTCYAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111345 Essential Splice Site 1404 1531 18 21
ENSDART00000135130 Essential Splice Site 1273 1390 16 19
ENSDART00000142085 None None 131 None 3
Genomic Location:
Chromosome 23 (position 23217787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATCCATTCGCACCTACACCTGCACCAACAGGATCCATTGCACCAAGG[T/C]GAGGGACCATTCTCTCTGTTCTTGTGTGACAAATTGTTTTATTAGGCCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pvfiz1bw