LOC556262

Ensembl ID:
ENSDARG00000077349
Human Orthologue:
SORCS3
Human Description:
sortilin-related VPS10 domain containing receptor 3 [Source:HGNC Symbol;Acc:16699]
Mouse Orthologue:
Sorcs3
Mouse Description:
sortilin-related VPS10 domain containing receptor 3 Gene [Source:MGI Symbol;Acc:MGI:1913923]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32145 Nonsense Mutation detected in F1 DNA During 2016
sa23046 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36383 Nonsense Mutation detected in F1 DNA During 2016
sa42908 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114236 Nonsense 119 1018 4 27
Genomic Location:
Chromosome 17 (position 20211126)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGTTTCTCTTTTGGCTGTAGCTCTACAGCTCTGTGGACTTCGGGAAG[A/T]AGTGGATTCTTGTTCACGAGCGAGTAACTCCAGGGAGATTTTACTGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114236 Essential Splice Site 461 1018 13 27
Genomic Location:
Chromosome 17 (position 20176298)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTCGACGGGGTTTTGATGACTCCAGAGACTGAGAATCGCATCATTAC[G/T]TAAGAATCATGTTCTCTGCCACACTGATCTCAATGGTCCAGAAGGGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114236 Nonsense 718 1018 19 27
Genomic Location:
Chromosome 17 (position 20167096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTAGGTCCCGTGGAGCGTATCTTTCTTTCGGCACCGGTGGTCGTGGCC[A/T]GAGGAAGAGAAGCCAACCTGACAGCAGTGTTGTGGCCCAGTCAGCCCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114236 Essential Splice Site 747 1018 19 27
Genomic Location:
Chromosome 17 (position 20167005)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCCCAGGACGGCCACCTTCTACTGGTGGTTCAATAACAACACTGAGG[T/C]TCGAACATTTATACGCATGCGGCCCAGAGGCCCACATCTGTTAGCCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link