ptrh2

Ensembl ID:
ENSDARG00000077339
ZFIN ID:
ZDB-GENE-050522-163
Description:
peptidyl-tRNA hydrolase 2, mitochondrial [Source:RefSeq peptide;Acc:NP_001018371]
Human Orthologue:
PTRH2
Human Description:
peptidyl-tRNA hydrolase 2 [Source:HGNC Symbol;Acc:24265]
Mouse Orthologue:
Ptrh2
Mouse Description:
peptidyl-tRNA hydrolase 2 Gene [Source:MGI Symbol;Acc:MGI:2444848]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41679 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114144   None 176 1 1
ENSDART00000142016 Essential Splice Site None 176 None 2
Genomic Location (Zv9):
Chromosome 10 (position 28990169)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28421763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATAATGTTTGCAATGTAGTTACCACTTATCGTTCTGTTGTTCTTCTTC[A/T]GACATGAGGCTGGACTCTCTGTACGGGCCGTTCGGTCTGGGTGTTCTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link