si:ch211-171h4.5

Ensembl ID:
ENSDARG00000077337
ZFIN ID:
ZDB-GENE-081104-151
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JL91]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6548 Nonsense Mutation detected in F1 DNA During 2017
sa9200 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114878 Nonsense 291 349 6 6
ENSDART00000142937   None 188 None 3
Genomic Location (Zv9):
Chromosome 19 (position 11089875)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10548414
KASP Assay ID:
554-5345.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTCACGCTGAGATGCCAAAGTGATGCCAACCCTGCAGTCCAGCRCTA[T/A]GAGTGGTACAAATACAATGSAAAWGGGAAGCTTGAGCTGCAGAATCAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9200
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114878 Nonsense 295 349 6 6
ENSDART00000142937   None 188 None 3
Genomic Location (Zv9):
Chromosome 19 (position 11089865)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10548404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGATGCCAAAGTGATGCCAACCCTGCAGTCCAGCRCTAWGAGTGGTAC[A/T]AATACAAWGSAAAWGGGAAGCTTGAGCTGCAGAATCAAGGACARACTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link