SH3TC1 (2 of 2)

Ensembl ID:
ENSDARG00000077330
Description:
SH3 domain and tetratricopeptide repeats 1 [Source:HGNC Symbol;Acc:26009]
Human Orthologue:
SH3TC1
Human Description:
SH3 domain and tetratricopeptide repeats 1 [Source:HGNC Symbol;Acc:26009]
Mouse Orthologue:
Sh3tc1
Mouse Description:
SH3 domain and tetratricopeptide repeats 1 Gene [Source:MGI Symbol;Acc:MGI:2678949]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21115 Nonsense Mutation detected in F1 DNA During 2017
sa34216 Nonsense Mutation detected in F1 DNA During 2017
sa34215 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21114 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110328 Nonsense 368 853 2 8
ENSDART00000110758 Nonsense 108 593 2 8
Genomic Location (Zv9):
Chromosome 7 (position 62510655)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 61557853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCAGACGCCACCACTGCGTTCATCTGGCTGGCATGGCTGTACATCTG[T/A]AACCAGCAGCCTGGCACAGCTCTAGAAGTGCTGGATGCTGTGCTGGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110328 Nonsense 428 853 2 8
ENSDART00000110758 Nonsense 168 593 2 8
Genomic Location (Zv9):
Chromosome 7 (position 62510477)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 61557675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCCGTCAGGCCGCTGAGAGCTATCAAGCCGCGATTGAGATTTGTGAG[G/T]AGTTTGAGGATAGACATAACTGGGCTGTGGCGCTGGCCAATTTTGGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110328 Essential Splice Site 517 853 3 8
ENSDART00000110758 Essential Splice Site 257 593 3 8
Genomic Location (Zv9):
Chromosome 7 (position 62507663)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 61554861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGCTGGTTGATGCACAAGTACCTTCATATTCTTCTTTATATGCCAAC[A/T]GGCCAACTGCACACCACTCGTCACCTGTGTGAGCTTTATGAAGATGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110328 Essential Splice Site 784 853 7 8
ENSDART00000110758 Essential Splice Site 524 593 7 8
Genomic Location (Zv9):
Chromosome 7 (position 62493535)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 61540733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGGGTTTACCAGACCCTTGGAGACATCATCTTTTATGACGTAAAGG[T/C]AACGTGAACACCTAATGAACACCAAATACTTCAATCCTCCATCTAGTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link