nlgn2a

Ensembl ID:
ENSDARG00000077329
ZFIN IDs:
ZDB-GENE-090918-2, ZDB-GENE-090918-2
Description:
neuroligin 2b [Source:RefSeq peptide;Acc:NP_001159801]
Human Orthologue:
NLGN2
Human Description:
neuroligin 2 [Source:HGNC Symbol;Acc:14290]
Mouse Orthologue:
Nlgn2
Mouse Description:
neuroligin 2 Gene [Source:MGI Symbol;Acc:MGI:2681835]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40875 Nonsense Mutation detected in F1 DNA During 2017
sa16117 Nonsense Available for shipment Available now
sa26941 Nonsense Mutation detected in F1 DNA During 2017
sa40874 Nonsense Mutation detected in F1 DNA During 2017
sa30629 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112978 Nonsense 13 810 1 7
ENSDART00000125284 Nonsense 13 828 1 8
Genomic Location (Zv9):
Chromosome 7 (position 23300704)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21865889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGGACAGTCATGTATTTGCCTCATGCCTGTAAACGGGATTTGGGCTA[T/A]GCCCACAATTCAGAGGTCACTCACACAATAGCTCTCTTCTGGTTGGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112978 Nonsense 56 810 1 7
ENSDART00000125284 Nonsense 56 828 1 8
Genomic Location (Zv9):
Chromosome 7 (position 23300576)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21865761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCGATCCTGGCACYAAATATCCTACAGTCACCACAAACTACGGMAAAT[T/A]GYGTGGGATTAAAAAAGAGCTKAACAATGAGATTCTGGGTCCCGTGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112978 Nonsense 74 810 1 7
ENSDART00000125284 Nonsense 74 828 1 8
Genomic Location (Zv9):
Chromosome 7 (position 23300521)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21865706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATTAAAAAAGAGCTTAACAATGAGATTCTGGGTCCCGTGGAACAATA[T/A]CTGGGCGTTCCTTATGCCACAGCGCCAATCGGAGACCGTCGCTTTCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112978 Nonsense 316 810 4 7
ENSDART00000125284 Nonsense 334 828 5 8
Genomic Location (Zv9):
Chromosome 7 (position 23119884)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21685069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCGTAAAGTGGGATGCACATATGGAGAGACCGCAGACCTGGTGGATTG[T/A]CTCCGCAGGAAAAATTTCAGAGAGCTGGTAGATCAGGACATCCAGCCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112978 Nonsense 328 810 4 7
ENSDART00000125284 Nonsense 346 828 5 8
Genomic Location (Zv9):
Chromosome 7 (position 23119850)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21685035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACCTGGTGGATTGTCTCCGCAGGAAAAATTTCAGAGAGCTGGTAGAT[C/T]AGGACATCCAGCCGGCCCGCTACCACATTGCATTTGGGCCGGTGATGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link