im:7137453

Ensembl ID:
ENSDARG00000077318
ZFIN ID:
ZDB-GENE-050208-63
Human Orthologues:
C10orf140, C17orf96
Human Descriptions:
chromosome 10 open reading frame 140 [Source:HGNC Symbol;Acc:32697]
chromosome 17 open reading frame 96 [Source:HGNC Symbol;Acc:34493]
Mouse Orthologues:
2810030E01Rik, E130012A19Rik
Mouse Descriptions:
RIKEN cDNA 2810030E01 gene Gene [Source:MGI Symbol;Acc:MGI:1919918]
RIKEN cDNA E130012A19 gene Gene [Source:MGI Symbol;Acc:MGI:2143991]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24471 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111079 Nonsense 167 767 1 2
ENSDART00000113284 Nonsense 167 762 1 3
Genomic Location (Zv9):
Chromosome 24 (position 17687719)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16994195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAGCTGTTCGACAAGATCCTGTTTCTCGCAGTCACTCAAATCTACCT[C/T]AAATTTATAGCAAATCCTTCGCCCGTGACTTTCAACCGGTGGCGAAGTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link