LOC565513

Ensembl ID:
ENSDARG00000077317
Human Orthologue:
SNX29
Human Description:
sorting nexin 29 [Source:HGNC Symbol;Acc:30542]
Mouse Orthologue:
Snx29
Mouse Description:
sorting nexin 29 Gene [Source:MGI Symbol;Acc:MGI:1921728]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15604 Nonsense Available for shipment Available now
sa12737 Nonsense Available for shipment Available now
sa22080 Nonsense Mutation detected in F1 DNA During 2014
sa9437 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 80 823 4 21
Genomic Location:
Chromosome 12 (position 20509204)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTAGCCCTCACAGCAGCTGCCATTAAACATGTTGCAGGATTTAGCAGT[A/T]AAACYGAAGCAGGYAMTGTAACTGGCTCCAGCAAMWAATGCACATCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 80 823 4 21
Genomic Location:
Chromosome 12 (position 20509204)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTAGCCCTCACAGCAGCTGCCATTAAACATGTTGCAGGATTTAGCAGT[A/T]AAACCGAAGCAGGYAMTGTAACTGGCTCCAGCAAMWAATGCACATCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 550 823 14 21
Genomic Location:
Chromosome 12 (position 20557054)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACATTTTTGCAGAGAGAATGAAGTTCTGAAGGTTCAGCTAAAGAAGTA[T/A]GTTGGGGCTGTCCAAATGCTGAAAAGGGAAGGCAGCCAAGGCGGTGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 571 823 15 21
Genomic Location:
Chromosome 12 (position 20611430)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAAATGCTTTGTCTAATGTGTTAYATTCTATTTCCAGCATTAACCAAT[C/T]ARAGGAATTGTGAAGGTCTGCCTCCTGCCCCCCAAAGCCGGTCTATGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iyqhzawp