LOC565513

Ensembl ID:
ENSDARG00000077317
Human Orthologue:
SNX29
Human Description:
sorting nexin 29 [Source:HGNC Symbol;Acc:30542]
Mouse Orthologue:
Snx29
Mouse Description:
sorting nexin 29 Gene [Source:MGI Symbol;Acc:MGI:1921728]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15604 Nonsense Available for shipment Available now
sa12737 Nonsense Available for shipment Available now
sa38885 Nonsense Mutation detected in F1 DNA During 2016
sa35267 Essential Splice Site Available for shipment Available now
sa22080 Nonsense Available for shipment Available now
sa35268 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9437 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 80 823 4 21
Genomic Location (Zv9):
Chromosome 12 (position 20509204)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19291048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTAGCCCTCACAGCAGCTGCCATTAAACATGTTGCAGGATTTAGCAGT[A/T]AAACYGAAGCAGGYAMTGTAACTGGCTCCAGCAAMWAATGCACATCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 80 823 4 21
Genomic Location (Zv9):
Chromosome 12 (position 20509204)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19291048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTAGCCCTCACAGCAGCTGCCATTAAACATGTTGCAGGATTTAGCAGT[A/T]AAACCGAAGCAGGYAMTGTAACTGGCTCCAGCAAMWAATGCACATCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 492 823 12 21
Genomic Location (Zv9):
Chromosome 12 (position 20540418)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19322262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGCGGCAAGCCATTGTGGCCATGATGAACCGAAAAGATGAACTCACT[G/T]AGCAGAACACGTAGGAATTTCTAAATTACCTTTACTGATGGCATACCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Essential Splice Site 538 823 13 21
Genomic Location (Zv9):
Chromosome 12 (position 20543364)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19325208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCGAGCTTGAGGAGAGACATGCTGCCAAAGTCCAAGCTCTCATGAGG[T/C]AATATCGCAATAGACTGACTGAAAAGTATTCTTACATAGACAAACTAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 550 823 14 21
Genomic Location (Zv9):
Chromosome 12 (position 20557054)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19338898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACATTTTTGCAGAGAGAATGAAGTTCTGAAGGTTCAGCTAAAGAAGTA[T/A]GTTGGGGCTGTCCAAATGCTGAAAAGGGAAGGCAGCCAAGGCGGTGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Essential Splice Site 567 823 15 21
Genomic Location (Zv9):
Chromosome 12 (position 20611417)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19393261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTATGGAAAATATAAATGCTTTGTCTAATGTGTTACATTCTATTTCC[A/T]GCATTAACCAATCAGAGGAATTGTGAAGGTCTGCCTCCTGCCCCCCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 571 823 15 21
Genomic Location (Zv9):
Chromosome 12 (position 20611430)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19393274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAAATGCTTTGTCTAATGTGTTAYATTCTATTTCCAGCATTAACCAAT[C/T]ARAGGAATTGTGAAGGTCTGCCTCCTGCCCCCCAAAGCCGGTCTATGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link