LOC564200

Ensembl ID:
ENSDARG00000077314
Human Orthologue:
MBLAC1
Human Description:
metallo-beta-lactamase domain containing 1 [Source:HGNC Symbol;Acc:22180]
Mouse Orthologue:
Mblac1
Mouse Description:
metallo-beta-lactamase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2679717]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2394 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113543 Nonsense 57 207 1 2
Genomic Location:
Chromosome 7 (position 27588449)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WACTTTAATCACTGGACCAAACAYTATTTTAGTGGACACAGGCGGTCCGT[G/A]GGACAGAGACTTTCTCGTGGCTAAACTCAAAGAGAAGGGTTTGACACCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p90oa1r3