B0V213_DANRE

Ensembl ID:
ENSDARG00000077310
Description:
Novel protein with a Pentaxin family domain [Source:UniProtKB/TrEMBL;Acc:B0V213]
Human Orthologue:
GPR144
Human Description:
G protein-coupled receptor 144 [Source:HGNC Symbol;Acc:18651]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13107 Nonsense Available for shipment Available now
sa34518 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109328 Nonsense 401 1066 6 25
ENSDART00000131450 Nonsense 426 614 7 10
Genomic Location (Zv9):
Chromosome 8 (position 54892827)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52812517
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAGAGTCTCTGAGGTCCAACCCCAGTCCCTTCATGCARAGTCTCATG[C/T]WGTACGGCATGGTAGGAGCTTTTTACCRTTAATATRGCACACACAATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109328 Essential Splice Site 872 1066 17 25
ENSDART00000131450   None 614 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 54876303)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52829041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCAGTGTCATTTGGGCTTTTGCAGGGCCGGTGCTCTTTGTTTTGGCT[G/A]TAAGTATGTCTTTTATCTTATTTCAGCTAATAGGATTGTAGAATACTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link