B0V213_DANRE

Ensembl ID:
ENSDARG00000077310
Description:
Novel protein with a Pentaxin family domain [Source:UniProtKB/TrEMBL;Acc:B0V213]
Human Orthologue:
GPR144
Human Description:
G protein-coupled receptor 144 [Source:HGNC Symbol;Acc:18651]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3679 Nonsense Mutation detected in F1 DNA During 2014
sa13107 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109328 Nonsense 200 1066 4 25
ENSDART00000131450 Nonsense 225 614 5 10
Genomic Location:
Chromosome 8 (position 54897414)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYCGCGGTCAAACCGACAGAAAGGTCCGCCTGGCGCTCCTCATTCAAGGG[C/T]AACATCATCCATACAAAGCCGAGCTGTCGGTCGAYGGAAACTGGCACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109328 Nonsense 401 1066 6 25
ENSDART00000131450 Nonsense 426 614 7 10
Genomic Location:
Chromosome 8 (position 54892827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAGAGTCTCTGAGGTCCAACCCCAGTCCCTTCATGCARAGTCTCATG[C/T]WGTACGGCATGGTAGGAGCTTTTTACCRTTAATATRGCACACACAATTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2iteln0r