cutc

Ensembl ID:
ENSDARG00000077306
ZFIN ID:
ZDB-GENE-041010-144
Description:
cutC copper transporter homolog [Source:RefSeq peptide;Acc:NP_001006046]
Human Orthologue:
CUTC
Human Description:
cutC copper transporter homolog (E. coli) [Source:HGNC Symbol;Acc:24271]
Mouse Orthologue:
Cutc
Mouse Description:
cutC copper transporter homolog (E.coli) Gene [Source:MGI Symbol;Acc:MGI:1913638]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22190 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111328 Essential Splice Site 126 251 6 9
Genomic Location:
Chromosome 13 (position 549096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATGCAGCCGGTGACTGTCTCTGTCAGACGTGCGCTGGTGTGTGTTTC[A/C]GCGTTCGATATGGTGCACGATCCACTGGTGGCTCTGGAAACTCTGATCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d9bn3w58