erg

Ensembl ID:
ENSDARG00000077304
ZFIN ID:
ZDB-GENE-041212-40
Description:
transcriptional regulator ERG [Source:RefSeq peptide;Acc:NP_001008616]
Human Orthologue:
ERG
Human Description:
v-ets erythroblastosis virus E26 oncogene homolog (avian) [Source:HGNC Symbol;Acc:3446]
Mouse Orthologue:
Erg
Mouse Description:
avian erythroblastosis virus E-26 (v-ets) oncogene related Gene [Source:MGI Symbol;Acc:MGI:95415]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31755 Nonsense Mutation detected in F1 DNA During 2016
sa17564 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108780 Nonsense 84 349 2 7
Genomic Location (Zv9):
Chromosome 10 (position 118450)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 165609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCAGCTCCACTTCCTCACTTGACTTCAGATGATGTTGACAAAGCCT[T/A]GCAAAACTCCCCGCGGTTAATGCATGCTCGCAACACAGGTAAGCAGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108780 Nonsense 183 349 7 7
Genomic Location (Zv9):
Chromosome 10 (position 121802)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 162161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAMTGATGGTGTGTGTTTTGTGGTCAGGCTCTGGTCAGATCCAGCTGTG[G/A]CAGTTCCTGCTGGAGCTSCTGTCYGACAGCTGCAACTCGTYCTGCATCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link