usp42

Ensembl ID:
ENSDARG00000077300
ZFIN ID:
ZDB-GENE-030131-5739
Description:
Ubiquitin carboxyl-terminal hydrolase [Source:UniProtKB/TrEMBL;Acc:Q802X0]
Human Orthologue:
USP42
Human Description:
ubiquitin specific peptidase 42 [Source:HGNC Symbol;Acc:20068]
Mouse Orthologue:
Usp42
Mouse Description:
ubiquitin specific peptidase 42 Gene [Source:MGI Symbol;Acc:MGI:1924050]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3820 Nonsense Mutation detected in F1 DNA During 2014
sa10774 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003375 Nonsense 47 1047 2 16
ENSDART00000134597 None None 74 None 4
Genomic Location:
Chromosome 12 (position 18656411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACATGGAGAGCAGTAGTTCGAGCTGGAGTGTTGGCCCTTCTGCCACT[G/T]AGCTTTCAAGGGCCAAGACGGTCTGTATGGCCCCGGCCATTGGWGCGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003375 Essential Splice Site 464 1047 12 16
ENSDART00000134597 None None 74 None 4
Genomic Location:
Chromosome 12 (position 18652169)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCACCACGTCCTTCATTGGCCCTCAACTGCCACCTCATATGCTGAAGG[T/A]AMTGCAAGACAATRAAACATCCTAGCAAAATCAGCACTGTGATGGATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5vdiqmt0