usp42

Ensembl ID:
ENSDARG00000077300
ZFIN ID:
ZDB-GENE-030131-5739
Description:
Ubiquitin carboxyl-terminal hydrolase [Source:UniProtKB/TrEMBL;Acc:Q802X0]
Human Orthologue:
USP42
Human Description:
ubiquitin specific peptidase 42 [Source:HGNC Symbol;Acc:20068]
Mouse Orthologue:
Usp42
Mouse Description:
ubiquitin specific peptidase 42 Gene [Source:MGI Symbol;Acc:MGI:1924050]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42004 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35250 Nonsense Mutation detected in F1 DNA During 2016
sa10774 Essential Splice Site Available for shipment Available now
sa35249 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003375 Essential Splice Site 244 1047 6 16
ENSDART00000134597   None 74 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18653542)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17464119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACCACTTTTGTACATCAGATTTTTGGAGGATATCTGAGATCCAGAGG[T/C]AGGTCACTCATTTCGTTTGACTCGGATTTAATGTATTTGTATTTGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003375 Nonsense 296 1047 9 16
ENSDART00000134597   None 74 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18653047)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17463624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCACTTTCATTCAAGCTGACAGTAATCTTTTTTTTGTCTTGTCAGATG[T/A]AAGAAAATGGTTACTGCCTCAAAGAGATTCACCGTTCATCGCAGTTCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003375 Essential Splice Site 464 1047 12 16
ENSDART00000134597   None 74 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18652169)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17462746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCACCACGTCCTTCATTGGCCCTCAACTGCCACCTCATATGCTGAAGG[T/A]AMTGCAAGACAATRAAACATCCTAGCAAAATCAGCACTGTGATGGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003375 Nonsense 857 1047 15 16
ENSDART00000134597   None 74 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18649251)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17459828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTCAGGTGAGGACCGGAACAGAGGGTCAGATCGACCACATTTTTCTT[C/A]AACCCCGAAGGACAGGGAACGATACAGGCACTATAGGGATCATAGTGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link