nbr1

Ensembl ID:
ENSDARG00000077297
ZFIN ID:
ZDB-GENE-030131-9112
Human Orthologue:
NBR1
Human Description:
neighbor of BRCA1 gene 1 [Source:HGNC Symbol;Acc:6746]
Mouse Orthologue:
Nbr1
Mouse Description:
neighbor of Brca1 gene 1 Gene [Source:MGI Symbol;Acc:MGI:108498]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30960 Nonsense Mutation detected in F1 DNA During 2017
sa42042 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11901 Essential Splice Site Available for shipment Available now
sa22111 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa30960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114556 Nonsense 36 1014 2 23
ENSDART00000133048 Nonsense 36 989 2 21

The following transcripts of ENSDARG00000077297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 28785350)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27122959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAATCTTACTGTGCCTTCTTTACATTTTCTGTTTATAACTTTTAGATT[A/T]AAACTACTTTCGGCTTGAGCCATTTTCAAGTGAAATATTTTGACGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114556 Essential Splice Site 55 1014 2 23
ENSDART00000133048 Essential Splice Site 55 989 2 21

The following transcripts of ENSDARG00000077297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 28785410)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27123019
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGCTTGAGCCATTTTCAAGTGAAATATTTTGACGAGGACAACGAAGAG[G/T]TAAATAATAACAGTTTAATTACGGGTTTATATCATCTTTGCATTTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114556   274 1014 9 23
ENSDART00000133048 Essential Splice Site 268 989 None 21

The following transcripts of ENSDARG00000077297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 28790001)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27127610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTATATRTWTGTTAAGGGAATTGAATTCATTTTTCTGTGTTGTTTTC[A/C]GGTTTCTGAGGCGGGGTGACAGGACGGTGAGAAAGGCGGAGAGGCAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114556 Missense 699 1014 17 23
ENSDART00000133048 Essential Splice Site 692 989 16 21

The following transcripts of ENSDARG00000077297 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 28792643)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27130252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGTTCCTGTGTCAAAGCCAATCATAACAGATGAACCTGTCTTTCCAG[G/A]TCTGCATGCCTTTTTTTTTTCTTGGTCACTGTTACTTAGGGTGCTTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link