A5PLH8_DANRE

Ensembl ID:
ENSDARG00000077295
Description:
LOC100002625 protein [Source:UniProtKB/TrEMBL;Acc:A5PLH8]
Human Orthologue:
AKAP6
Human Description:
A kinase (PRKA) anchor protein 6 [Source:HGNC Symbol;Acc:376]
Mouse Orthologue:
Akap6
Mouse Description:
A kinase (PRKA) anchor protein 6 Gene [Source:MGI Symbol;Acc:MGI:3050566]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13083 Nonsense Available for shipment Available now
sa7821 Nonsense Mutation detected in F1 DNA During 2014
sa19161 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105333 Nonsense 1186 2142 12 14
ENSDART00000109573 None None 304 None 4
Genomic Location:
Chromosome 17 (position 9099034)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCTATCAACAACCCCAATATAATCACAAATCATCTCCAGCCAAAGCG[C/T]AGCAATCACTGCTCARGAGAGTRAGCATGGATTCATCCTTCTCCTCGGCY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105333 Nonsense 1546 2142 12 14
ENSDART00000109573 None None 304 None 4
ENSDART00000105333 Nonsense 1546 2142 12 14
ENSDART00000109573 None None 304 None 4
Genomic Location:
Chromosome 17 (position 9100115)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGAGACAGATGCTAGTATCAGTATGGTTGTTAACATTTCWTGCACAT[C/A]AGCCTGCACCGACGATGAAGAAGACAGCGATCTTCTCTCCAGCTCCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105333 Nonsense 1546 2142 12 14
ENSDART00000109573 None None 304 None 4
ENSDART00000105333 Nonsense 1546 2142 12 14
ENSDART00000109573 None None 304 None 4
Genomic Location:
Chromosome 17 (position 9100115)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGAGACAGATGCTAGTATCAGTATGGTTGTTAACATTTCATGCACAT[C/A]AGCCTGCACCGACGATGAAGAAGACAGCGATCTTCTCTCCAGCTCCACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k28aw6wh