MMP25 (1 of 2)

Ensembl ID:
ENSDARG00000077290
Description:
matrix metallopeptidase 25 [Source:HGNC Symbol;Acc:14246]
Human Orthologue:
MMP25
Human Description:
matrix metallopeptidase 25 [Source:HGNC Symbol;Acc:14246]
Mouse Orthologue:
Mmp25
Mouse Description:
matrix metallopeptidase 25 Gene [Source:MGI Symbol;Acc:MGI:2443938]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11222 Essential Splice Site Available for shipment Available now
sa17999 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11222
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110611 Essential Splice Site 80 576 2 10
Genomic Location:
Chromosome 3 (position 32758116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCGCAAAATGCAACGATTTGCTGGCATCGAAGAGACTGGGAACTTGG[G/A]TAACAGTTTATTATTGCACCCACAGTTGAGGACACAATTATTAGCCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110611 Nonsense 509 576 10 10
Genomic Location:
Chromosome 3 (position 32765452)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCATTTCCCTCAGGAGAAACCTACTTTTTYAAAGACTCAAACTACTG[G/A]ATTTTACAAAGAGGAGGTCTGGATCTGGAATCTGCTTCTCCGAAGTCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yzxn53dj