si:ch211-188c16.1

Ensembl ID:
ENSDARG00000077288
ZFIN ID:
ZDB-GENE-070912-162
Description:
si:ch211-188c16.1 [Source:RefSeq peptide;Acc:NP_001170918]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31250 Nonsense Available for shipment Available now
sa17455 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113774 Nonsense 137 760 2 18
Genomic Location (Zv9):
Chromosome 2 (position 2503660)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2371312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTCTCCTCTGAAATTCATCAAGAAACCAATCCCCACGCCTTTCAGTT[T/A]GACCAAAGTGTCAGTATGCACCAAGGAATATGGGAAAAACGGGAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113774 Nonsense 425 760 5 18
Genomic Location (Zv9):
Chromosome 2 (position 2499850)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2367502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGTCTGTCAGTCTTCAGAGGAGAAGAGAAATGTTGGGGYTTTGCCGT[T/A]GACTACAGAGACGGTGACCTCTGACCTTAGGGTGAACGGATMACACACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link