sb:cb986

Ensembl ID:
ENSDARG00000077270
ZFIN IDs:
ZDB-GENE-031116-23, ZDB-GENE-031116-23
Description:
LOC572121 protein [Source:UniProtKB/TrEMBL;Acc:A5PL99]
Human Orthologue:
INCENP
Human Description:
inner centromere protein antigens 135/155kDa [Source:HGNC Symbol;Acc:6058]
Mouse Orthologue:
Incenp
Mouse Description:
inner centromere protein Gene [Source:MGI Symbol;Acc:MGI:1313288]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25220 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa19355 Nonsense Mutation detected in F1 DNA During 2017
sa10414 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114610   None 331 None 7
ENSDART00000114694 Nonsense 18 324 2 9
ENSDART00000121440 Splice Site None 759 None 21
Genomic Location (Zv9):
Chromosome 25 (position 3563909)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3539071
KASP Assay ID:
554-7715.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTAGGAAACGGGACGAGCGTTTGAAACGGGTTGTAGAGGCTCGAGTG[A/T]AAAGCGAAAAGGAGAAGGAGCAGGAAAAGAAAAAGAAGATCGAAGAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114610   None 331 None 7
ENSDART00000114694 Nonsense 84 324 3 9
ENSDART00000121440 Nonsense 547 759 12 21
ENSDART00000114610   None 331 None 7
ENSDART00000114694 Nonsense 84 324 3 9
ENSDART00000121440 Nonsense 547 759 12 21
Genomic Location (Zv9):
Chromosome 25 (position 3563624)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3539356
KASP Assay ID:
554-6222.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCTGCGCAGGAAACAGGAAGAGGCGGCGAGACAAAAGAAACAGCAG[C/T]AAGTTGTAAGTCAATCCTGCAATAAAAGGTGCTATTTGGACCTGGTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114610   None 331 None 7
ENSDART00000114694 Nonsense 84 324 3 9
ENSDART00000121440 Nonsense 547 759 12 21
ENSDART00000114610   None 331 None 7
ENSDART00000114694 Nonsense 84 324 3 9
ENSDART00000121440 Nonsense 547 759 12 21
Genomic Location (Zv9):
Chromosome 25 (position 3563624)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3539356
KASP Assay ID:
554-6222.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGARMTGCGCAGGAAACAGGAAGAGGCGGYRAGACAAAAGAAACAGCAG[C/T]AAGTTGTAAGTCAATCCWGCAATAAAARGTGYTATTTGGACCTGGTGTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link