SGIP1

Ensembl ID:
ENSDARG00000077269
Description:
SH3-domain GRB2-like (endophilin) interacting protein 1 [Source:HGNC Symbol;Acc:25412]
Human Orthologue:
SGIP1
Human Description:
SH3-domain GRB2-like (endophilin) interacting protein 1 [Source:HGNC Symbol;Acc:25412]
Mouse Orthologue:
Sgip1
Mouse Description:
SH3-domain GRB2-like (endophilin) interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920344]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13141 Essential Splice Site Available for shipment Available now
sa39788 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31264 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110723 Essential Splice Site 131 641 6 23
Genomic Location (Zv9):
Chromosome 2 (position 14423727)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14721771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAATCACACTCAATTACTGAGATGATTTCCTCTGCTCTTTTCTTTTCA[C/T]ACACAGAGAAAGAGTCCGGTAAGCAAATGCATKCACACTTTAAAGATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110723 Essential Splice Site 446 641 18 23
Genomic Location (Zv9):
Chromosome 2 (position 14364999)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14663043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTACAGCCGGCTGGAGCAGGTCCTTCCCAACCCGCAACTTCTGTGCTG[G/T]TAACATCTGCATTAGTGATGTCTAATTAGCGAACAAATGGTTAATTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110723 Nonsense 466 641 19 23
Genomic Location (Zv9):
Chromosome 2 (position 14332351)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14630395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACCTACAGGTGACATGAAGGAGTTCTGGGTGAATATGCCAAACTTGT[T/A]AAGCCACCTGAAGAAAGTGGCTGAGCAGAGGCCACAGGCCACATATTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link