LOC565801

Ensembl ID:
ENSDARG00000077249
Human Orthologue:
GMIP
Human Description:
GEM interacting protein [Source:HGNC Symbol;Acc:24852]
Mouse Orthologue:
Gmip
Mouse Description:
Gem-interacting protein Gene [Source:MGI Symbol;Acc:MGI:1926066]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11596 Essential Splice Site Available for shipment Available now
sa2096 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa11596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108639 Essential Splice Site 14 809 1 20
Genomic Location:
Chromosome 3 (position 53375839)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCAGATGGANNNNNNNNNGGAGACTGCACAGCTGAGGCAGCCCAAAG[G/A]TCAGACTGGGTTTCTTTRAGAYTTTAAGGGAAAYTTTCAGAGTAAAAYGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2096
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108639 Nonsense 655 809 18 20
Genomic Location:
Chromosome 3 (position 53425683)
KASP Assay ID:
554-2678.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTTTACAAYGACTTCATYGCTGTGGGTAAGGAGATTCAGAGGCTCAGC[G/T]AAAAGGACCACGCCGCTGAGTCTCCTGGGATTGTGGAGAATATAGTGCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ar3hytcy