LOC565801

Ensembl ID:
ENSDARG00000077249
Human Orthologue:
GMIP
Human Description:
GEM interacting protein [Source:HGNC Symbol;Acc:24852]
Mouse Orthologue:
Gmip
Mouse Description:
Gem-interacting protein Gene [Source:MGI Symbol;Acc:MGI:1926066]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11596 Essential Splice Site Available for shipment Available now
sa33312 Nonsense Mutation detected in F1 DNA During 2016
sa40166 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2096 Nonsense F2 line generated During 2016
sa33313 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108639 Essential Splice Site 14 809 1 20
Genomic Location (Zv9):
Chromosome 3 (position 53375839)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52483154
KASP Assay ID:
2259-4123.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCAGATGGANNNNNNNNNGGAGACTGCACAGCTGAGGCAGCCCAAAG[G/A]TCAGACTGGGTTTCTTTRAGAYTTTAAGGGAAAYTTTCAGAGTAAAAYGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108639 Nonsense 173 809 7 20
Genomic Location (Zv9):
Chromosome 3 (position 53410820)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52518135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTGATTGATCTATTTGGACAGGATATGATGCCTCTACAGAATATCTA[C/A]ACACAGGCGCTGGAGCATGATCTCAAGACCAGCGCATCAGCCAAACAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108639 Essential Splice Site 423 809 12 20
Genomic Location (Zv9):
Chromosome 3 (position 53420866)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52528181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACGCACTGCCAGATGATCTAAAACACAGCAGCAGTTTAGTAGATGGAC[G/A]TAAGTCTGATTCCTGTCATGAACTTTGTTGGATTTATCTAGTGCTCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2096
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108639 Nonsense 655 809 18 20
Genomic Location (Zv9):
Chromosome 3 (position 53425683)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52532998
KASP Assay ID:
554-2678.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTTTACAAYGACTTCATYGCTGTGGGTAAGGAGATTCAGAGGCTCAGC[G/T]AAAAGGACCACGCCGCTGAGTCTCCTGGGATTGTGGAGAATATAGTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33313
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108639 Essential Splice Site 806 809 19 20
Genomic Location (Zv9):
Chromosome 3 (position 53432373)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52539688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTCAGGACCCCACAGCCACGTCTAGAGAACGTCCGCGCTCACTGGAG[G/A]TAGGCAATAATGCCGTGACCAGGCTAAAAAAGCTCCCCTCAGGTGGATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link