ENSDARG00000077245

Ensembl ID:
ENSDARG00000077245
Human Orthologue:
COL21A1
Human Description:
collagen, type XXI, alpha 1 [Source:HGNC Symbol;Acc:17025]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24424 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15530 Nonsense Available for shipment Available now
sa16013 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066866 Essential Splice Site 27 957 1 29
Genomic Location:
Chromosome 24 (position 547758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTATCCTGGTGTTTTCACACGCTGCCAAGGACGATGATGTTCGAGCAG[G/A]TATGATCAGATTCTGATAATGGCTCAGTGGTTAGCACTGTGTTTCTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066866 Nonsense 256 957 3 29
Genomic Location:
Chromosome 24 (position 550584)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAGAAAGCCAARAAGATCCAGGGCTCACTGGTGTCAGAGGGGGCGTA[T/A]CTRCTGGAYAAGACCACYGACATCACTGAAAACACAAGGTCAGGGNNNNT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16013
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066866 Essential Splice Site 657 957 19 29
Genomic Location:
Chromosome 24 (position 573994)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGGGGCCTTCAGGGACCCCTGGAGCAGACGGAGCYCGCGGCCCCAAG[G/T]TGAGAATCCTCCARAGACGCGCTAATTTTTAATKATTAATTATTCTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/53gxxke8