setd1bb

Ensembl ID:
ENSDARG00000077244
ZFIN ID:
ZDB-GENE-080522-1
Description:
SET domain containing 1Bb [Source:UniProtKB/TrEMBL;Acc:A5XCC1]
Human Orthologue:
SETD1B
Human Description:
SET domain containing 1B [Source:HGNC Symbol;Acc:29187]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34447 Nonsense Mutation detected in F1 DNA During 2017
sa30902 Nonsense Mutation detected in F1 DNA During 2017
sa41257 Nonsense Mutation detected in F1 DNA During 2017
sa34446 Nonsense Mutation detected in F1 DNA During 2017
sa21340 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114080 Nonsense 107 1789 3 23
Genomic Location (Zv9):
Chromosome 8 (position 35896608)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 34825032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAAATGTGTAAATGCTTTGGAGAGATTCAAGATTTGAAAGTTTTTTA[T/A]AATCCAAAGAACAAGAAACATTTAGGACTAGCAAAGGTTGTTTTTGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114080 Nonsense 1130 1789 16 23
ENSDART00000114080 Nonsense 1130 1789 16 23
Genomic Location (Zv9):
Chromosome 8 (position 35888614)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 34817038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCAGCTCAAATGGAAGACCCAGAGGAAGAACTGAGTGTACGAGTGTA[T/A]ATGCAGGGACTAAAACTGCCTGAGCCTCTCAGATACACCTTACAGGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114080 Nonsense 1130 1789 16 23
ENSDART00000114080 Nonsense 1130 1789 16 23
Genomic Location (Zv9):
Chromosome 8 (position 35888614)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 34817038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCAGCTCAAATGGAAGACCCAGAGGAAGAACTGAGTGTACGAGTGTA[T/A]ATGCAGGGACTAAAACTGCCTGAGCCTCTCAGATACACCTTACAGGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114080 Nonsense 1296 1789 17 23
Genomic Location (Zv9):
Chromosome 8 (position 35886210)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 34814634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACTTCCATCCTCACCCCTTTACTACGGTATTCCTCTCCTGTCATCATA[T/A]CCTGGATATGAGGAAATCCCAAAAACACCAGGCAGAGTCAATGATCCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114080 Nonsense 1766 1789 23 23
Genomic Location (Zv9):
Chromosome 8 (position 35881327)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 34809751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTACTCACGACAACCTATCACTGTAAATGAAGAGATCACTTACGATTA[C/A]AAATTTCCTATTGAGGATGAGAAAATCCCCTGTCTGTGTGCTGCGGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link