LOC795669

Ensembl ID:
ENSDARG00000077243
Human Orthologue:
ABCC3
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 3 [Source:HGNC Symbol;Acc:54]
Mouse Orthologues:
Abcc3, Gm11169
Mouse Descriptions:
ATP-binding cassette, sub-family C (CFTR/MRP), member 3 Gene [Source:MGI Symbol;Acc:MGI:1923658]
predicted gene 11169 Gene [Source:MGI Symbol;Acc:MGI:3779424]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41927 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21991 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114196 Essential Splice Site 58 1532 2 35
Genomic Location (Zv9):
Chromosome 12 (position 923456)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 720580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAATATGATCTCATATGAATGAGAAGTGTGTGTGTGTGTGTGTGTGCA[G/T]GTTCTGGGCCTGATTCTGTGGATCGTCTGCTGGACGGATCTGTTTTCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114196 Essential Splice Site 1432 1532 32 35
Genomic Location (Zv9):
Chromosome 12 (position 979934)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 776952
KASP Assay ID:
2260-4768.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCTGCCAAACTGGAGCTGGAGTGCTCAGAAGGAGGAGAAAACCTCAG[G/A]TGACGCTTACGGTTTAAAACACAATAATCAACAGCTTTCCACAGATTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link