LOC795669

Ensembl ID:
ENSDARG00000077243
Human Orthologue:
ABCC3
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 3 [Source:HGNC Symbol;Acc:54]
Mouse Orthologues:
Abcc3, Gm11169
Mouse Descriptions:
ATP-binding cassette, sub-family C (CFTR/MRP), member 3 Gene [Source:MGI Symbol;Acc:MGI:1923658]
predicted gene 11169 Gene [Source:MGI Symbol;Acc:MGI:3779424]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7680 Nonsense Mutation detected in F1 DNA During 2014
sa21991 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114196 Nonsense 433 1532 10 35
Genomic Location:
Chromosome 12 (position 939741)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGACGCGCAGCGCTTCATGGATCTCACCACCTTCCTCAACATGCTGTG[G/A]TCKGCGCCGCTGCAGATCTTCCTGGCGCTCTTCTTCCTCTGGCAGGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114196 Essential Splice Site 1432 1532 32 35
Genomic Location:
Chromosome 12 (position 979934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCTGCCAAACTGGAGCTGGAGTGCTCAGAAGGAGGAGAAAACCTCAG[G/A]TGACGCTTACGGTTTAAAACACAATAATCAACAGCTTTCCACAGATTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lgbiw4sf