eif3ha

Ensembl ID:
ENSDARG00000077242
ZFIN ID:
ZDB-GENE-040808-19
Description:
Eukaryotic translation initiation factor 3 subunit H-A [Source:UniProtKB/Swiss-Prot;Acc:Q6AXJ2]
Human Orthologue:
EIF3H
Human Description:
eukaryotic translation initiation factor 3, subunit H [Source:HGNC Symbol;Acc:3273]
Mouse Orthologue:
Eif3h
Mouse Description:
eukaryotic translation initiation factor 3, subunit H Gene [Source:MGI Symbol;Acc:MGI:1915385]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11156 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044634 Nonsense 30 335 2 8
ENSDART00000110583 Nonsense 30 335 2 8
ENSDART00000143670 Nonsense 30 79 2 2
Genomic Location:
Chromosome 16 (position 51578188)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAAGGAAAGTTTCCTGAATGTGTGTTTTTRTGCRTCTGCAGGTGGTGT[T/A]GAAGATCAYTAAGCACTACCAGGAGGAGGGCCAGGGCAGCGAGGTGGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pdfnhiu1