cd247l

Ensembl ID:
ENSDARG00000077240
ZFIN ID:
ZDB-GENE-070508-2
Description:
CD247 antigen like [Source:RefSeq peptide;Acc:NP_001093577]
Human Orthologue:
CD247
Human Description:
CD247 molecule [Source:HGNC Symbol;Acc:1677]
Mouse Orthologue:
Cd247
Mouse Description:
CD247 antigen Gene [Source:MGI Symbol;Acc:MGI:88334]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18398 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114351 Essential Splice Site 131 152 7 8
ENSDART00000140349 Essential Splice Site 147 168 7 8
Genomic Location:
Chromosome 9 (position 35330649)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTATCTTTTTGTTGCAGCCACGCAAAGCCAAGAGCAAATCTAATGAG[G/A]TAATGTGATTTMATTTTTCTTGGTTTAATATTTGAAATGSCGATCATTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oeqq4ix0