LOC560368

Ensembl ID:
ENSDARG00000077237
Human Orthologue:
RFX7
Human Description:
regulatory factor X, 7 [Source:HGNC Symbol;Acc:25777]
Mouse Orthologue:
Rfx7
Mouse Description:
regulatory factor X, 7 Gene [Source:MGI Symbol;Acc:MGI:2442675]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20999 Nonsense Mutation detected in F1 DNA During 2014
sa15627 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111303 Nonsense 335 1509 8 9
Genomic Location:
Chromosome 7 (position 35994728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGGCAGATGGGGGCATAACTCCTGTAGCAGGCACAGGCATACCCTGT[G/T]GAAGTCCTGCTCTTCTGTCGCCACAACCTATTGGCATTGTGGTTGCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111303 Nonsense 842 1509 9 9
Genomic Location:
Chromosome 7 (position 35996390)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAATGAAAGGTGTCTTTTGGGAGAGTGAGCTKCAAGATGGCACTCAA[C/T]AACATCAAGATGTTTATGGTGCACAAATGGTGCCTGAGCCAAAGAAAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2sidn4c5