LOC562782

Ensembl ID:
ENSDARG00000077229
Human Orthologue:
ANO8
Human Description:
anoctamin 8 [Source:HGNC Symbol;Acc:29329]
Mouse Orthologue:
Ano8
Mouse Description:
anoctamin 8 Gene [Source:MGI Symbol;Acc:MGI:2687327]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41774 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10269 Nonsense Available for shipment Available now
sa41773 Nonsense Mutation detected in F1 DNA During 2016
sa13612 Nonsense Available for shipment Available now
sa38823 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108628 Essential Splice Site 138 1110 3 17
Genomic Location (Zv9):
Chromosome 11 (position 6023268)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5991451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAAACACACCCGAATGTACGCCTTCTTTGTCACCGCCACATATGAAAA[G/A]TAAGAGGGGATTGGAGGGAAACTGATTTATCTGTCTTTTATGTGTGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108628 Nonsense 502 1110 13 17
Genomic Location (Zv9):
Chromosome 11 (position 6006309)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5974492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATACTCCTGCAGATGCTGGCCACGCTGCTGATTATCCGGCAGTTTGTG[C/T]AGAACATGAAGGAAGTCCTGCAGCCCTACCTGGCRGAGCGGCACCGATTR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108628 Nonsense 717 1110 13 17
Genomic Location (Zv9):
Chromosome 11 (position 6005664)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5973847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTGACAGCAAGACCAAGAGAGATTCGTGGATGGATCCTCCTGAGGAG[C/T]AAGAAACCAACACACTCACACAGGCAGAGGTTGAGGGCTGCATGCAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108628 Nonsense 797 1110 14 17
Genomic Location (Zv9):
Chromosome 11 (position 6004062)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5972245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCACCAGCCTACAGAGACCGYTCGGCCTGAGGGTGGCGAGCATCGGA[C/T]AATGGCAGGTTCGACAACACTGACTACTCTAAMAAATCCTTAATATACKC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38823
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108628 Nonsense 1093 1110 17 17
Genomic Location (Zv9):
Chromosome 11 (position 6000310)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5968493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGTCTGACCTCAATGGGGTGCCGGACGAAATCCCATCTCCTTGTGGA[G/T]AGAATGGGGAAAATGGATCCTCATCCGATGCTGATCCATCAGGCCCTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link