LOC562782

Ensembl ID:
ENSDARG00000077229
Human Orthologue:
ANO8
Human Description:
anoctamin 8 [Source:HGNC Symbol;Acc:29329]
Mouse Orthologue:
Ano8
Mouse Description:
anoctamin 8 Gene [Source:MGI Symbol;Acc:MGI:2687327]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10269 Nonsense Available for shipment Available now
sa13612 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108628 Nonsense 502 1110 13 17
Genomic Location:
Chromosome 11 (position 6006309)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATACTCCTGCAGATGCTGGCCACGCTGCTGATTATCCGGCAGTTTGTG[C/T]AGAACATGAAGGAAGTCCTGCAGCCCTACCTGGCRGAGCGGCACCGATTR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108628 Nonsense 797 1110 14 17
Genomic Location:
Chromosome 11 (position 6004062)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCACCAGCCTACAGAGACCGYTCGGCCTGAGGGTGGCGAGCATCGGA[C/T]AATGGCAGGTTCGACAACACTGACTACTCTAAMAAATCCTTAATATACKC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/egr1aar8